lillllllllll
Intellectual Property Consultants
Patents - Trademarks - Designs
Estabi.. 1876
*22-09-04-1254372*
The Belgian Chamber of
Industrial Property Consultants
Ficpi - Aippi - Inta - Bmm - Union
Belgian & European Patent Attorneys
Benelux & Community Trademark Agents
Le 22 septembre 2004
N/Réf. : FdK/ND/VD
OFFICE DE LA PROPRIETE
INTELLECTUELLE (O.P.R.I.)
Boulevard du Roi Albert II, 16
B-1000 BRUXELLES
J£S^332-
Brevet européen N° 1 254 372 délivré le 23 juin 2004
au(x) nom(s) de Clinical Micro Sensors, Inc.
INFORMATIQUE
i 24.09.2004
Messieurs,
Conformément à l'article 5.1 de la loi du 8 juillet 1977, nous annexons à la
présente, un exemplaire de la traduction du fascicule du brevet européen cité en rubrique.
Une formule de procuration nous mandatant pour cette opération vous
parviendra ultérieurement.
Veuillez agréer, Messieurs, nos salutations distinguées.
J2 2.-9-20CA. |
Bi^$î «N%A»S»-iM***,M
CABIN
EDE S.A.
de Kemmeter, François
Mand. Agr. 0801
P.S. : Prière de nous retourner le duplicata ci-joint à titre d'accusé de réception.
CABINET BEDE s.a-M.v.
Boulevard General Wahis 15
1030 BRUSSELS
Belgium
Tel : + 32 2 779 03 39
Fax : + 32 2 772 47 80
E-MAIL : mail@bede.be
BTW / TVA : BE 458.484.455
HRB / RCB : 604.465
Bank KBC 439-3182001-09
Bank BBL 310-0690840-92
Postgiro 000-1520213-29
G£NUWI. TERMS (SEE W-VfcRSfc ÏIIU-) / CONDITIONS G'-MEHALU (VOIR VERSO) / ALG
^miïiinnif?«(11) Numéro de publication
européen : 1 254 372
(12) TRADUCTION DU BREVET EUROPEEN (B1)
(21) Numéro de dépôt de la demande
de brevet européen : 00 978 615.3
(22) Date de dépôt de la demande
de brevet européen : 13.11.2000
(54) Titre: techniques d'acceleration de liaison pour la
DETECTION D'ANALYTES
(73) Titulaire(s) du brevet :
Clinical Micro Sensors, Inc.
(45) Numéro et date du Bulletin européen où la mention de (a délivrance a été
publiée : 04/26 du 23.06.200410
^IcZSy à^L
DOMAINE DE L'INVENTION
La présente invention concerne les compositions et les
procédés utiles à 1'accélération de la fixation d'analytes
afin de capturer des ligands sur des surfaces. La détection a
lieu par de 1'utilisation d'une moitié de transfert
d'électrons (ETM) qui est associée avec l'analyte cible, soit
directement ou indirectement, pour permettre la détection
électronique de l'ETM.
ARRIERE-PLAN DE L'INVENTION
Il existe un grand nombre de dosages et de ces deux capteurs
pour la détection de la présence et/ou de la concentration de
15 substance spécifiques dans les fluides et les gaz. Beaucoup
reposent sur les réactions spécifiques ligands/antiligands
comme le mécanisme de détection. C'est-à-dire, des paires de
substances (c'est-à-dire des paires de fixation ou
ligands/antiligands) sont connues pour se fixer l'une à
20 1 * autre, alors qu'elles se fixent peu ou pas du tout àd'autres substances. Cela a été le centre de nombre de
techniques qui utilisent ces paires de fixation pour la
détection des complexes. Ils sont généralement effectués par
le marquage d'un composant du complexe d'une manière ou d'une
5 autre, afin de rendre le complexe entier détectable en
utilisant par exemple, des radio isotopes, des fluorescents,
et d'autres molécules, enzymes, etc., actives optiquement
parlant.
10 D'autres dosages reposent sur des signaux électroniques pour
la détection. Les biocapteurs sont tout particulièrement
intéressant. On connaît au moins deux types de biocapteurs ;
les biocapteurs métaboliques ou basés sur des enzymes et les
biocapteurs de fixation ou de bioaffinité. Voir par exemple
15 les brevets des Etats-Unis N° 4 713 347 ; 5 192 507 ; 4 920
04 7 ; 3 8 73 267 ; et les références décrites ici. Alors que
certains de ces capteurs connus utilisent des techniques de
courant alternatif (AC), ces techniques sont généralement
limitées à la détection de différences dans l'impédance du
20 substrat (ou diélectrique).
On connaît l'utilisation de I'électrophorèse dans les procédés
microfluidiques pour faciliter la fixation de molécules
biologiques à leurs partenaires de fixation pour la détection
25 ultérieure ; voir par exemple les brevets des Etats-Unis N° 5
605 662 et 5 632 957, et les références décrites ici.
De manière similaire, on connaît la détection électronique
d'acides nucléiques utilisant des électrodes ; voir par
30 exemple les brevets des Etats-Unis 5 591 578 ; 5 824 473, 5
705 348, 5 780 234 et 5 770 369 ; U.S.S.N. 08/911 589 et le
document WO 98/20162 : PCT/US98/12430 ; PCT/US98/12082 ;
PCT/US99/10104 ; PCT/US99/01705 et PCT/US99/01703.
35 L'un des obstacles significatifs des applications de
biocapteurs est le taux auquel l'analyte cible se fixe à la
surface pour la détection et l'affinité pour la surface. Ilexiste nombre de techniques qui ont été développées dans les
applications d'acides nucléiques soit pour accélérer le taux
de fixation, soit pour concentrer l'échantillon à la surface
de détection. Ceci inclut la précipitation d'acides nucléique
5 (voir EP 0 229 44?' Al, y compris l'addition de détergents
(voir Pontius et al-, PNAS USA 88:8237 (1991)) ; la séparation
d'acides nucléiques dans des systèmes à deux phases de liquide
(voir Albertsson et al., Biochimica et Biophysica Acta 103:1-
12(1965), Kohne et al., Biochem, 16(24):5329(1977) et Müller,
10 Partitioning of Nucleic Acids, Ch.7 in Partitioning in Aqueous
Two-Phase Systems, Academic Press, 1985)), tout comme la
séparation en présence de macroligands (voir Müller et al.,
Anal Biochem. 118:269 (1981)) ; et l'addition de protéines de
fixation d'acides nucléiques (voir Pontius et al., PNAS USA
15 87:8403 (1990) et brevet des Etats-Unis N° 5 015 569). De plus
on a aussi développé les systèmes de séparation pour certaines
protéines, voir Gineitis et al., Anal, Biochem. 139:400
(1984) .
20 Cependant, il existe un besoin pour un système qui combine
l'accélération de la fixation des analytes, y compris les
acides nucléiques, à une électrode de détection pour une
détection électronique ultérieure.
25 RESUME DE L'INVENTION
En accord avec les objets gravement exposés ci-dessus, la
présente invention fournit des compositions comprenant un
substrat comprenant une première surface comprenant une rangée
30 d'électrodes de détection comprenant chacune un ligand de
capture lié de manière covalente et au moins une première
électrode d'électrophorèse. Le substrat comprend aussi une
seconde surface comprenant au moins une seconde électrode
d'électrophorèse et au moins un canal reliant les première et
35 seconde surfaces. Les canaux peuvent comprendre des membranes
ou des matériaux de couche de permeation comme brièvement
exposé ici.Sous un autre aspect, la présente invention fournit des
compositions comprenant une chambre de détection comprenant un
substrat comprenant une première surface comprenant une rangée
5 d'électrodes de détection comprenant chacune un ligand de
capture lié, de manière covalente. La surface comprend aussi
une seconde surface et au moins un canal reliant la première
et la seconde surfaces. La chambre de détection comprend aussi
un matériau absorbant en contact avec la seconde surface. De
10 nouveau les canaux peuvent comprendre des membranes ou des
matériaux de couches de permeation comme exposé brièvement
ici.
Sous un aspect supplémentaire, la présente invention fournit
15 des procédés pour la détection d'une analyte cible dans un
échantillon comprenant la concentration de l'analyte cible
dans la chambre de détection comme ci-dessus, et fixant
l'analyte cible au ligand de capture pour former un complexe
de dosage. De plus, le complexe de dosage comprend au moins
20 une moitié de transfert d'électrons (ETM). Le procédé comprend
la détection de la présence d'ETM en utilisant l'électrode de
détection.
Sous un autre aspect, la présente invention fournit des
25 procédés pour la détection d'une analyte cible dans un
échantillon. Les procédés comprennent la concentration de
l'analyte cible dans une chambre de détection comprenant une
électrode de détection comprenant un ligand de capture lié de
manière covalente. L'analyte cible est fixée au ligand de
30 capture pour former un complexe de dosage comprenant au moins
une moitié de transfert d'électrons (ETM). La présence de
l'ETM est alors détectée en utilisant l'électrode de
détection.
35 Sous un autre aspect, l'étape de concentration comprend le
placement de l'échantillon dans un champ électrique entre au
moins une première électrode et au moins une seconde électrodesuffisantes pour causer un transport électrophorétique de
l'échantillon vers l'électrode de détection.
Sous un aspect supplémentaire, 1'étape de concentration
5 comprend au moins un agent d'exclusion de volume dans la
chambre de détection.
Sous un autre aspect l'étape de concentration comprend la
précipitation de l'analyte cible.
10
Sous un aspect supplémentaire, l'étape de concentration
comprend y compris au moins deux réactifs qui forment deux
phases de solution séparables, de manière à ce que l'analyte
cible se concentre dans 1'une des phases.
15
Sous un autre aspect, l'étape de concentration comprend la
fixation de l'analyte cible à une particule.
Sous un aspect supplémentaire, 1'invention fournit des
20 procédés pour la détection d'analyte cible comprenant la
circulation de l'échantillon devant l'électrode de détection
comprenant un ligand de capture lié de manière covalente dans
des conditions qui ont pour résultat la formation d'un
complexe de dosage. Comme ci-dessus, le complexe de dosage
25 comprend en outre au moins une moitié de transfert d'électrons
(ETM), et la présence de 1'ETM est détectée en utilisant
ladite électrode de détection.
Sous un autre aspect, les procédés sont pour la détection des
30 acides nucléiques cibles et incluent l'utilisation
d'accélérateurs d'hybridation. Le complexe de dosage est formé
en présence d'un accélérateur d'hybridation, qui peut être un
acide nucléique fixant une protéine ou un ion polyvalent.
35 Sous un aspect supplémentaire, l'invention fournit des
procédés'de détection d'une analyte cible dans un échantillon
comprenant l'addition de l'échantillon à une électrode dedétection en comprenant un ligand de capture lié d'une manière
covalente sous des conditions qui résultent en la formation
d'un complexe de dosage. Les conditions incluent la présence
de particules de mélange.
5
Sous un autre aspect, l'invention fournit des substrats
comprenant une pluralité d'électrodes en or. Chaque électrode
en or comprend une couche monomoléculaire auto-assemblée, un
ligand de capture, et une interconnexion de manière à ce que
10 chaque électrode soit indépendamment adressable. Les substrats
préférés incluent du matériau de cartes de circuits imprimées
comme de la fibre de verre.
Sous un aspect supplémentaire, l'invention fournit des
15 procédés pour faire un substrat comprenant une pluralité
d'électrodes en or. Les méthodes comprennent le recouvrement
de métal d'adhésion sur un substrat de fibres de verre, et un
revêtement d'or sur le métal d'adhésion. Un modèle est alors
formé en utilisant la lithographie, et le modèle comprend la
20 pluralité des électrodes et des interconnexions associées. Les
procédés incluent optionnellement l'addition d'une couche
mononucléaire auto-assemblée à chaque électrode (SAM).
Sous un autre aspect, l'invention fournit des procédés pour
25 créer un substrat comprenant une pluralité d'électrodes en or.
Les procédés comprennent le revêtement d'un métal d'adhésion
sur un substrat, et le revêtement d'or sur le métal
d'adhésion. Un modèle est alors formé en utilisant la
lithographie, et le modèle comprend la pluralité des
30 électrodes et des interconnexions associées. La méthode inclut
en outre l'addition d'une couche mononucléaire auto-assemblée
(SAM) à chaque électrode.
35
BREVE DESCRIPTION DES DESSINS
Les figures IA, IB, IC, ID, IE et IF représentent de
nombreuses configurations représentatives de 1 'utilisation dedeux sets d'électrodes, un set d'électrophorèse et un set de
détection. Sur les figures IA et IB, un substrat 30 a une
première électrode d'électrophorèse 10 avec des électrodes de
détection 20 soit au-dessus soit incorporées mais
5 électriquement isolées de l'électrode d'électrophorèse. Il y a
un échantillon recevant de même une zone 40. L'électrode
auxiliaire pour I'électrophorèse et les électrodes de
détection ne sont pas montrées. La figure IC représente une
vue de côté de la figure IA, avec l'addition de l'électrode
10 d'électrophorèse auxiliaire 50 et optionnellement l'électrode
de détection auxiliaire 60. Une couche de permeation 25 est
aussi montrée. Comme 1'appréciera 1'homme du métier, ces
électrodes auxiliaires peuvent être la même électrode, si
elles sont utilisées de manière séquentielle. Les figures ID,
15 IE et IF représentent l'utilisation des électrodes
d'électrophorèse individuelles. La figure IE est une vue de
côté de la figure ID. La figure IF montre la configuration
pour bouger de manière séquentielle un échantillon d'une
électrode de détection à l'autre, tel que décrit de manière
20 plus complète ci-dessous.
La figure 2 représente l'utilisation de rangées d'électrodes
d'électrophorèse multidimensionnelles à la fois pour le
ciblage spatial de l'échantillon et pour "le mélange afin
25 d'augmenter la cinétique de fixation. La figure 2A montre des
électrodes d'électrophorèse 10 et des électrodes de détection
20. Le voltage d'électrophorèse appliqué comme entre les
électrodes d'électrophorèse 10 et 15, et au même moment, aux
électrodes d'électrophorèse 12 et 17, peut conduire l'analyte
30 cible à l'électrode de détection 20.
Les figures 3A, 3B et 3C représentent trois modes de
réalisation préférés pour attacher une séquence cible à
l'électrode. La figure 3A représente une séquence cible 120
35 hybridée à une sonde de capture 100 liée par un lieur de
liaison 106, lequel comme expliqué brièvement ici peut être
soit un oligomère conducteur soit un isolateur.L'électrode 105 comprend une mononucléaire d'agent de
passivation 107, qui peut comprendre les oligomères
conducteurs (représentés ici en 108) et/ou des isolateurs
(représentés ici en 109). Comme tous les modes de réalisation
5 représentés sur les figures, n est un nombre entier au moins
égal à 1, bien que comme 1 ' appréciera 1 ' homme du métier, le
système peut ne pas utiliser de sonde de capture du tout
(c'est-à-dire n est égal à zéro), bien que ce ne soit
généralement pas préféré. La limite supérieure de n va
10 dépendre de la longueur de la séquence cible et de la
sensibilité requise. La figure 3B représente 1'utilisation
d'une seule sonde d'extendeur de capture 110 avec une première
portion 111 qui va s'hybrider à une première portion de la
séquence cible 120 et une seconde portion qui va s'hybrider à
15 la sonde de capture 100. La figure 3C représente l'utilisation
de deux sondes d'extendeur de capture 110 et 130. La première
sonde d'extendeur de capture 110 a une première portion 111
qui va s'hybrider à une première portion de la séquence cible
120 et une seconde portion 112 qui va s'hybrider à la première
20 portion 102 de la sonde de capture 100. La seconde sonde
d'extendeur de capture 130 a une première portion 132 qui va
s'hybrider à une seconde portion de la séquence cible 120 et
une seconde portion 131 qui va s'hybrider à une seconde
portion 101 de la sonde de capture 100. Comme l'apprécier
25 l'homme du métier, chacune de ces configurations de liaison
peut être utilisée avec les modes de réalisation des figures 4
5 et 6.
Les figures 4A, 4B, 4C et 4D représentent plusieurs systèmes
30 possibles de mécanisme-1. Les figures 4A, 4B et 4C
représentent plusieurs systèmes d'acides nucléiques possibles.
Sur la figure 4A, une sonde de détection 140 (qui sert aussi
de sonde de capture) est attachée à une électrode 105 par
l'intermédiaire d'un oligomère conducteur 108. L'électrode 105
35 comprend en outre une couche mononucléaire d'agents de
passivation 107. La séquence cible 120 s'hybride à la sonde de
détection 140, et une ETM 135 est lié (soit de manièrecovalente à l'une ou l'autre des séquences cibles soit à la
sonde de détection soit de manière non covalente, c'est-à-dire
comme un indicateur d'hybridation). Sur la figure 4B on
utilise une liaison de la figure 3A à l'électrode, avec une
5 sonde de capture 10'0 liée à l'électrode 105 en utilisant un
lieur de liaison 106, qui peut être soit un isolateur soit un
oligomère conducteur. La séquence cible 120 est hybridée à la
sonde de capture, et une sonde de traçage 145, comprenant une
première portion 141 qui s'hybride à une portion de la
10 séquence cible 105 et un lieur de recrutement 142, qui
s'hybride à une sonde de détection 14 0 qui est liée à
l'électrode par l'intermédiaire d'un oligomère conducteur 108.
La figure 4C est similaire, sauf qu'une première sonde
d'extendeur de capture 110 est montrée, et une sonde
15 d'amplification 150, comprenant une première portion 152, qui
va s'hybrider à une seconde portion de la séquence cible 120
et une seconde portion (séquence d'amplification) 152 qui va
s'hybrider à une première portion 141 de la sonde de traçage
145. Une seconde portion 142 de la sonde de traçage 145
20 s'hybride à la sonde de détection 140, avec au moins une ETM
135 présente. La figure 3C utilise une liaison de la figure 3B
à l'électrode. La figure 4D représente une analyte cible non
nucléique 165 fixé à un ligand de fixation de capture 160, lié
à l'électrode 105 par l'intermédiaire d'un lieur de liaison
25 106. Un ligand de fixation de solution 170 se fixe aussi à une
analyte cible et comprend un lieur de recrutement 171 qui
comprend un acide nucléique qui va s'hybrider à la sonde de
détection 140 avec au moins une ETM 135 présente.
30 Les figures 5A, 5B, 5C, 5D, 5E, 4F et 4G représentent certains
des modes de réalisation du mécanisme-2 de l'acide nucléique
de l'invention. Toutes les couches mononucléaires représentées
ici montrent la présence à la fois d'oligomères conducteurs
108 et d'isolateurs 107 à un rapport de 1:1 à peu près, bien
35 que, comme discuté ici, une variété de différents rapports
peut être utilisée, ou l'isolateur peut être complètement
absent. En outre, comme l'appréciera l'homme du métier,10
n'importe laquelle de ces structures peut être répétée pour
une séquence cible particulière, c'est-à-dire pour les
séquences cibles longues, il peut y avoir de multiples
complexes de dosage formés. De plus, n'importe lequel des
5 modes de réalisation à liaison d'électrodes de la figure 3
peut être utilisé dans n'importe lequel de ces systèmes.
Les figures 5A, 5B et 5D ont la séquence cible 120 contenant
les ETM 135 ; comme discuté ici, ils peuvent être ajoutés
10 enzymatiquement, par exemple au cours d'une réaction PCR
utilisant des nucleotides modifiés avec des ETM, résultant
essentiellement en une incorporation au hasard tout au .long de
la séquence cible, ou ajoutés à la fin de la séquence cible.
La figure 5C représente l'utilisation de deux sondes de
15 capture différentes 100 et 100', qui s'hybrident à différentes
portions de la séquence cible 120. Comme 1'appréciera 1'homme
du métier, l'orientation 5'-3' des deux sondes de capture dans
ce mode de réalisation est différent.
20 La figure 5C représente l'utilisateur de sondes de traçage 145
qui s'hybrident directement à la séquence cible 120. La figure
5C montrent l'utilisation d'une sonde de traçage 145,
comprenant une première portion 141 qui s'hybride à une
portion de la séquence cible 120, une seconde portion 142
25 comprenant des ETM 135.
Les figures 5E, 5F et 5G représentent des systèmes utilisant
des sondes de traçage 145 qui ne s'hybrident pas directement à
la cible, mais plutôt à des sondes d'amplification qui sont
30 directement (figure 5E) ou indirectement (figures 5F et 5G)
hybridées à la séquence cible. La figure 5E utilise une sonde
d'amplification 150 et a une première portion 151 qui
s'hybride à la séquence cible 120 et au moins une seconde
portion 152, c'est-à-dire la séquence d'amplification, qui
35 s'hybride à la première portion 141 de la sonde de traçage. La
figure 5F est similaire, sauf qu'une première sonde
d'extendeur de traçage 160 est utilisée, comprenant une11
première portion 161 qui s'hybride à la séquence cible 120 et
une seconde portion 162 qui s'hybride à la première portion
151 de la sonde d'amplification 150. Une seconde portion 152
de la sonde d'amplification 150 s'hybride à une première
5 portion 141 de la sonde de traçage 140, qui comprend aussi un
lieur de recrutement 142 comprenant des ETM 135. La figure 5G
ajoute une seconde sonde d'extendeur de traçage 170, avec une
première portion 171 qui s'hybride à une portion de la
séquence cible 120 et une seconde portion qui s'hybride à une
10 portion de la sonde d'amplification.
La figure 5H représente un système qui utilise de multiples
sondes de traçage. La première portion 141 de la sonde de
traçage 140 peut s'hybrider à tout ou partie du lieur de
15 recrutement 142.
Les figures 6A-6H représentent certains des modes de
réalisation possibles de mécanisme-2 des acides non
nucléiques. La figure 6A utilise un ligand de fixation de
20 capture 200 lié à l'électrode 105 par un lieur de fixation
106. L'analyte cible 205 se fixe au ligand de fixation de
capture 200 et à un ligand de fixation de solution 210 avec un
lieur de recrutement 220 qui comprend des ETM 135. La figure
6B représente un cas similaire, sauf que le ligand de fixation
25 de capture 200 est lié à la surface en utilisant une seconde
interconnexion de partenaire de fixation, par exemple un acide
nucléique ; une portion 201 du ligand de fixation de capture
va se fixer ou s'hybrider à la sonde de capture 100 sur la
surface. La figure 6C utilise aussi une seconde interconnexion
30 de fixation, par exemple une interconnexion d'acide nucléique,
pour amplifier le signal. Dans ce cas, le ligand de fixation
de solution 210 comprend une première portion 220 qui va se
fixer ou s'hybrider à une première portion 231 d'une sonde de
traçage 230. La sonde de traçage 230 comprend aussi une
35 seconde portion 232 qui est un.lieur de recrutement. La figure
6D représente un mode de réalisation similaire au 6A, avec
1'utilisation d'un second ligand de fixation de solution 24 0.12
La figure 6E représente le cas où plus d'un ligand de fixation
de capture (200 et 200') est utilisé. La figure 6F montre une
conformation dans laquelle l'addition de cible altère la
conformation des ligands de fixation, causant le placement du
5 lieur de recrutement 220 près de la surface de la couche
monomoléculaire. La figure 6G montre l'utilisation de la
présente invention dans le dépistage d'un agent bioactif, dans
lequel l'addition d'un candidat de médicament pour cible cause
la dissociation du ligand de fixation de solution, causant une
10 perte de signal. De plus, le ligand de fixation de solution
peut être ajouté à une autre surface et être fixé, comme le
représente de manière générale la figure 6H pour les enzymes.
La figure 6H représente l'utilisation d'un enzyme pour fondre
un substrat comprenant un lieur de recrutement, causant une
15 perte de signal. La pièce fendue peut aussi être ajoutée à une
électrode supplémentaire, causant une augmentation du signal,
utilisant soit un système de mécanisme-1 ou un système de
mécanisme-2.
20 Les figures 7A, 7B, 7C, 7D et 7E représentent différentes
configurations possibles de sondes de traçage et de liaisons
d'ETM. Sur les figures 7A-C, le lieur de recrutement est
l'acide nucléique ; sur les figures 7D et E, ça ne l'est pas.
A = remplacement de nucleoside ; B = liaison à une base ; C =
25 liaison à ribose ; D = liaison à phosphate ; E = polymère de
métallocène (bien que comme décrit ici, ce peut aussi être un
polymère d'autres ETM) lié à une base, ribose ou phosphate (ou
autres analogies de squelette) ; F - structure dendrimère liée
par l'intermédiaire d'une base, ribose ou phosphate (ou autres
30 analogies de squelette) ; G = liaison par l'intermédiaire
d'une structure de "ramification", au travers de base, ribose
ou phosphate (ou autres analogie du squelette) ; H = liaison
de polymère de métallocène (ou d'autres ETM) ; I = liaison par
l'intermédiaire d'une structure dendrimère ; J - liaison
35 utilisant des lieurs standard. .13
Les figures 8A et 8B représentent un schéma d'un procédé
remplaçant l'addition de grand nombre d'ETM simultanément à un
acide nucléique en utilisant une phosphoramidite à point de
"ramification", comme connu dans la technique. Comme
j
5 l'appréciera l'homme du métier, chaque point final peut
contenir n'importe quel nombre d'ETM.
La figure 9 représente le schéma de la synthèse de
l'incorporation simultanée de multiples ETM dans un acide
10 nucléique, en utilisant un nucleoside à point de
"ramification" .
La figure 10 représente la synthèse d'un point de
"ramification" (dans ce cas une adenosine), pour permettre
15 l'addition de polymères d'ETM.
La figure 11 représente l'utilisation d'un carboxylate activé
pour l'addition d'un acide nucléique fonctionnalisé avec une
amine primaire à un SAM préformé.
20
La figure 12 représente une structure en épingle à cheveux
représentative. 500 est une séquence de fixation cible, 510
est une séquence en boucle, 520 est une région auto
complémentaire, 530 est sensiblement complémentaire à une
25 sonde de détection et 530 est "1'extrémité collante", c'est-à-
dire une portion qui ne s'hybride pas à toute autre portion de
la sonde, qui contient les ETM.
Les figures 13A, 13B 13C et 13D représentent certains modes de
30 réalisation de l'invention.
La figure 14 représente les résultats de l'exemple
expérimental.
35 Les figures 15A, 15B, 15C, 15D, 15E, 15F et 15G représentent
de nombreuses configurations possibles de deux systèmes
d'électrodes. En vue de côté figure 15A, un substrat 30 est14
placé sur une électrode d'électrophorèse 10 contenant des
électrodes de détection 20. Le substrat 30 a des trous ou des
canaux à l'intérieur. Tout comme pour les canaux représentés
ici, le canal peut être optionnellement rempli avec un
5 matériau de couche ' de permeation 25 ; alternativement, une
membrane comme la membrane de dialyse peut être utilisée à
chaque fin du canal. Le matériau de couche de permeation,
comme l'agarose, l'acrylamide, etc., permet le passage d'ions
pour I'électrophorèse mais empêche de préférence des
10 composants d'échantillons, comme les analytes cibles, d'entrer
dans la couche de permeation. Cependant, comme 1'appréciera
l'homme du métier, ces canaux peuvent être ouverts, .et par
conséquent remplis avec du tampon. L'électrode auxiliaire 50
peut être placée n'importe où. En établissant le champ
15 électrique entre l'électrode d'électrophorèse 10 et
1'électrode auxiliaire 50, 1'échantillon passe dans le
voisinage de l'électrode de détection. La figure 15B montre un
établissement similaire, mais l'électrode d'électrophorèse 10
n'est pas en contact direct avec la couche de permeation ; un
20 matériau conducteur ionique 27 est plutôt utilisé ; les modes
de réalisation préférés utilisent le tampon. La figure 15C
représente une configuration "asymétrique, dans laquelle
l'électrode auxiliaire 50 est sur l'un des côtés de la rangée
d'électrode de détection et le canal est sur l'autre. La
25 figure 15D est similaire mais "symétrique". La figure 15E
utilise deux sets d'électrodes d'électrophorèse ; cela permet
une première étape d'électrophorèse utilisant les électrodes
51 et 11, qui peuvent être utilisées pendant un certain temps,
suivie par une seconde étape d'électrophorèse utilisant les
30 électrodes 52 et 12. Les figures 15F et 15G représentent une
vue du dessus d'un substrat 30 ; l'autre électrode
d'électrophorèse est sur l'autre côté du substrat et n'est pas
montrée. Dans ce mode de réalisation, les électrodes de
détection 20 entourent un canal, rempli optionnellement avec
35 du matériau de permeation 25. Par conséquent, la figure 15F a
un canal, et les électrodes de détection sont réparties autour15
du canal. Sur la figure 15G, chaque bloc a un canal à
1'intérieur.
Les figures 16A, 16B, 16C représentent des systèmes,
5 similaires aux systèmes de la figure 15, dans lequel plutôt
que d'utiliser I'électrophorèse, l'accélération d'hybridation
est accomplie en utilisant un matériau absorbant, similaire à
un agent d'exclusion de volume, ou des combinaisons
d'électrophorèse et d'un matériau absorbant. Sur la figure
10 16A, 1'introduction de 1'échantillon dans la chambre 4 0
résulte dans le drainage du liquide à travers le canal
(optionnellement rempli par une couche de permeation), dans
une chambre comprenant du matériau adsorbant 500. La figure
16B montre une configuration alternative dans laquelle la
15 séparation par exclusion de taille (par exemple la membrane
cellule perméable) est sur la surface du substrat (par exemple
carte à circuit imprimé) . Les figures 16C, 16D, 16E et 16F
représentent une variété de configurations combinant
l'utilisation d'un matériau absorbant et I'électrophorèse.
20 Comme 1'appréciera 1'homme du métier, ce système peut aussi
être utilisé avec d'autres techniques d'accélération
d'hybridation.
25
DESCRIPTION DETAILLEE DE L'INVENTION
La présente invention est dirigée vers des procédés et des
compositions utiles à la détection d'espèces d'analyte cible
biologique comme les acides nucléiques et les protéines basés
sur la détection électrochimique sur une électrode. Comme
30 montré dans la technique, l'un des obstacles significatifs des
biocapteurs, particulièrement les biocapteurs pour la
détection des acides nucléiques, est le taux de fixation
(c'est-à-dire l'hybridation dans le cas des acides nucléiques)
de la cible basé sur la solution au ligand de capture fixé à
35 la surface. Voir par exemple Gingeras et al., Nucl. Acid Res.
13:5373 (1987) , ici incorporé à titre de référence dans sa
globalité. Ceci peut être affecté de nombreuses manières16
différentes, y compris (1) en concentrant l'analyte cible près
de la surface, ce qui résulte effectivement en une quantité
plus importante d'analyte cible se fixant au ligand de
capture ; (2) en configurant les systèmes pour permettre une
5 bonne circulation ou "mélange", à nouveau en permettant à une
plus grosse ..quantité d'analyte cible de se fixer au ligand de
capture ; ou, (3) dans le cas des acides nucléiques, en
utilisant les accélérateurs d'hybridation, qui augmentent en
fait le taux d'hybridation dans les complexes de dosage
10 comprenant la séquence cible et les sondes de capture. On se
réfère parfois à chacun des trois ici en tant qu'accélération
d'hybridation ou de fixation, en comprenant que certaines de
ces techniques n'augmentent pas réellement les taux constants
de fixation, ils augmentent la quantité d'analyte cible fixée
15 par unité de temps en augmentant la concentration ou en
améliorant le transport de masse. Par conséquent, la présente
invention est dirigée vers l'utilisation de compositions et de
procédés pour augmenter le nombre de molécules cibles fixées à
la surface au cours d'une unité de temps donnée. Alors qu'un
20 certain nombre des techniques expliquées brièvement ici est
généralement donné en exemple avec les acides nucléiques,
l'homme du métier reconnaîtra l'applicabilité de toutes les
techniques à d'autres analytes cibles y compris les protéines.
25 Ainsi, la présente invention décrit un nombre de techniques
qui peuvent être utilisées pour accélérer le taux de formation
de complexes de dosage ou augmenter le nombre de complexes de
dosage dans une période de temps donnée, dans laquelle
l'analyte cible devient associé à un ligand de capture sur la
30 surface de l'électrode. Ces techniques incluent le transport
électrophorétique, mais n'y sont pas limitées ; l'utilisation
d'agents d'exclusion de volume ; l'utilisation de protéines se
fixant aux acides nucléiques (dans le cas d'analytes cibles
d'acide nucléique) ; l'utilisation d'ions polyvalents ; les
35 agents de précipitation ; la séparation ; 1 ' ajustement de la
phase de' compatibilité ; la structuration des paramètres de
flux ; l'utilisation de microparticules (y compris à la fois17
les particules magnétiques et non magnétiques) permettant soit
"des navettes" soit "des mélangeurs" ; l'utilisation de
gradients de température ; l'utilisation de filtres ; et des
combinaisons de ceux-ci.
5
En conséquence, la présente invention fournit des procédés
pour détecter une analyte cible dans des solutions
échantillons. Comme l'appréciera l'homme du métier, la
solution d'échantillon peut comprendre m'importe quel nombre
10 de choses, y compris les fluides corporels mais ne s'y
limitant pas (y compris, mais ne s'y' limitant pas, le sang,
l'urine, le sérum, la lymphe, la salive, les sécrétions anales
et vaginales, la transpiration et le sperme, de tout organisme
virtuellement, des échantillons mammaires étant préférés et
15 les échantillons humains étant particulièrement préférés) ;
les échantillons environnementaux (y compris, mais ne s'y
limitant pas, les échantillons d'air, d'agriculture, d'eau et
de sol) ; les échantillons d'agents de guerre biologique ; les
échantillons de recherche (c'est-à-dire dans le cas des acides
20 nucléiques, 1'échantillon peut être les produits d'une
réaction d'amplification, y compris à la fois l'amplification
du signal et de la cible comme il est généralement décrit dans
PCT/US99/01705, comme les réactions d'amplification de PCR ou
de SDA) ; des échantillons purifiés, comme 1'ADN génomique
25 purifiée, l'ARN, les protéines etc., les échantillons bruts
(bactéries, virus, ADN génomique, etc., comme l'appréciera
l'homme du métier, virtuellement toute manipulation
expérimentale peut avoir été faite sur l'échantillon.
30 Les procédés sont dirigés vers la détection d'analyte cible.
Par "analytes cibles" ou équivalents grammaticaux on entend
ici toute molécule ou composé à détecter. Comme expliqué
brièvement ci-dessous, les analytes cibles se fixent de
préférence aux ligands de fixation, comme il est décrit plus
35 amplement ci-dessous. Comme 1'appréciera 1'homme du métier, un
grand nombre d'analytes peuvent être détectés en utilisant les
méthodes présentes ; basiquement, tout analyte cible pourlequel un ligand de fixation, décrit ci-dessous, peut être
fait peut être détecté en utilisant les procédés de
1'invention.
5 Lorsque I'électrophorèse est utilisée, comme il est expliqué
de manière,. plus ample ci-dessous, l'analyte cible est de
préférence chargée c'est-à-dire qu'il transporte une charge
nette dans des conditions expérimentales, de manière à pouvoir
être transporté électrophorétiquement dans un champ
10 électrique. Cependant, des analytes cibles non chargés peuvent
être utilisés si un partenaire de fixation chargé ou un ligand
de fixation est associé à l'analyte cible. Par exemple, comme
il est décrit plus amplement ci-dessous, dans le cas de
certains analytes cibles, par exemple des protéines, qui
15 transportent peu ou pas de charges nettes, des ligands de
fixation solubles peuvent être utilisés pour se fixer aux
analytes cibles qui contiennent des ETM et/ou des espèces
chargées ; dans certains modes de réalisation, 1'ETM peut être
chargée, et facilite ainsi à la fois I'électrophorèse et la
20 détection.
Les analytes convenables incluent les molécules organiques et
inorganiques, y compris les biomolécules. Dans un mode de
réalisation préféré, l'analyte peut être un polluant
25 environnemental (y compris des pesticides, des insecticides,
des toxines, etc.) ; un produit chimique (y compris des
solvants, des matériaux organiques, etc.) ; des molécules
thérapeutiques (y compris des médicaments thérapeutiques et
des drogues, des antibiotiques, etc.) ; des biomolécules (y
30 compris des hormones, des cytokines, des protéines, des
lipides, des hydrates de carbone, des antigènes de membranes
cellulaires et des récepteurs (des récepteurs neuronaux,
hormonaux, nutritifs, et de surface de cellule) ou leurs
ligands, etc.) ; toutes les cellules (y compris les procaryote
35 (comme les bactéries pathogènes) et les cellules eucaryote, y
compris 'les cellules de tumeurs mammaires) ; les virus (y
compris les retrovirus, les virus de l'herpès, les adenovirus,19
les lentivirus, etc.) ; et les spores ; etc. les analytes
particulièrement préférés sont les polluants environnementaux,
les acides nucléiques ; les protéines (y compris les enzymes,
les anticorps, les antigènes, les facteurs de croissance, les
5 cytokines etc.) ; les médicaments thérapeutiques et les
drogues ; les cellules ; et les virus.
Les analytes cibles particulièrement préférés incluent les
protéines et les acides nucléiques. "Protéine", comme utilisé
10 ici inclut les protéines, les polypeptides, et les peptides.
La protéine peut être faite d'acides aminés naturels, et de
chaînes de peptides, ou de structures peptidomimétiques
synthétiques. Les chaînes latérales peuvent être dans les
configurations soit (R) soit (S) . Dans le mode de réalisation
15 préféré, les acides aminés sont dans la configuration L ou
(S). Si des chaînes latérales non naturelles sont utilisées,
les substituants qui ne sont pas des acides aminés peuvent
être utilisés, par exemple, pour empêcher ou retarder les
dégradations in vivo.
20
Par "acide nucléique" ou "oligonucleotide" ou des équivalents
grammaticaux on entend ici au moins deux nucleotides liés
ensemble de manière covalente. Un acide nucléique de la
présente invention va généralement contenir des chaînes de
25 phosphodiester ; alors que dans certains cas, comme expliqué
brièvement ci-dessous, des analogues d'acide nucléique sont
inclus qui peuvent avoir des squelettes variés, comprenant par
exemple, la phosphoramidé (Beaucage et al. , Tetrahedron
49(10):1925 (1993) et références ici ; Letsinger, J. Org.
30 Chem. 35:3800 (1970) ; Sprinzl et al., Eur. J. Biochem, 81:579
(1977) ; Letsinger et al., Nucl. Acids Res. 14:3487 (1986) ;
Sawai et al. Chem. Lett. 805 (1984), Letsinger et al., J. Am.
Chem. Soc. 110:4470 (1988) ; et Pauwels et al. Chemica Scripta
26:141 91986)), phosphorothioate (Mag et al., Nucleic Acids
35 Res. 19:1437 (1991) ; et le brevet des Etats-Unis N° 5 644
048) phdsphorodithioate (Briu et al., J. Am. Chem. Soc.
111:2321 (1989), les liaisons O-méthylphosphoroamidites (voir20
Eckstein, Oligonucleotides and Analogues : A Practical
Approach, Oxford University Press), et des squelettes d'acide
nucléique peptidique et liaisons (voir Egholm, J. Am. Chem.
Soc. 114:1895 (1992) ; Meier et al., Chem. Int. Ed. Engl.
5 31:1008 (1992) ; Nie'lsen, Nature, 365:566 (1993) ; Carlsson et
al., Nature.. 380:207 (1996) , chacun est incorporé à titre de
référence). D'autres acides nucléiques analogues incluent ceux
avec des structures bicycliques y compris les acides
nucléiques ' verrouillés, et Koshkin et al. J. Am. Chem. Soc.
10 120:13252-3 (1998) ; les squelettes positifs (Denpcy et al.,
Proc. Natl. Acad. Sei. USA 92:6097 (1995) ; les squelettes
nonioniques (brevets des Etats-Unis N° 5 386 023, 5 637 684, 5
602 240, 5 216, 141 et 4 469 863 ; Kiedrowshi et al., Angew,
Chem. Intl. Ed. English 30:423 (1991) ; Letsinger et al., J.
15 Am. Chem. Soc. 110:4470 (1988) ; Letsinger et al., Nucleoside
& Nucleotide 13:1597(1994) ; Chapitres 2 et 3, ASC Symposium
Series 580, "Carbohydrate Modifications in Antisense
Research", Ed. Y. S. Sanghui and P. Dan Cook ; Mesmaeker et
al. , Bioorganic & Medicinal Chem. Lett. 4:395 (1994) ; Jeffs
20 et al. J. Biomolecular NMR 34:17 (1994) ; Tetrahedron Lett.
37:743 (1996)) et les squelettes non-ribose, y compris ceux
décrits dans les brevets des Etats-Unis N° 5 235 033 et 5 034
506, et les chapitres 6 et 7, ASC Symposium Series 580
"Carbohydrate Modifications in Antisense Research", Ed. Y. S.
25 Sanghui and P. Dan Cook. Les acides nucléiques contenant un ou
plusieurs sucres carbocycliques sont aussi inclus dans la
définition des acides nucléiques (voir Jenkins et al. Chem.
Soc. Rev. (1995) pages 169 à 176). De nombreux analogues
d'acide nucléique sont décrits dans Rawls, C & E News June 2,
30 1997 pages 35.
Ces modifications de squelette ribose-phosphate peuvent être
faites pour faciliter l'addition d'ETM ou pour augmenter la
stabilité et la demi-vie de telles molécules dans des
35 environnements physiologiques.21
10
Comme l'appréciera l'homme du métier, tous ces analogues
d'acides nucléiques peuvent trouver une utilité dans la
présente invention. De plus, les mélanges d'acides nucléiques
naturels et d'analogues peuvent être faits ; par exemple, sur
le site de 1 ' oligomère conducteur ou de la liaison ETM, une
structure analogue peut être utilisée. En variante, des
mélanges d'analogues d'acides nucléiques différents, et des
mélanges d'acides nucléiques naturels et d'analogues peuvent
être faits.
Sont particulièrement préférés l'es acides nucléiques
peptidiques (PNA) qui incluent des analogues d'acides
nucléiques peptidiques. Ces squelettes sont substantiellement
nonioniques dans des conditions neutres, en contraste avec le
15 squelette phosphodiester fortement chargé des acides
nucléiques naturels. Cela donne deux avantages. Premièrement,
le squelette de PNA montre une cinétique d'hybridation
améliorée. Les PNA ont des changements supérieurs en
température de fusion (Tm) pour des paires de bases
20 parfaitement associées contre des paires de bases non
parfaitement associées. L'ADN et 1'ARN montrent typiquement
une chute de 2 à 4 °C de Tm pour une mauvaise association
interne. Avec le squelette non ionique de PNA, la chute est
plus proche de 7 à 9 °C. Cela permet une meilleure détection
25 des mauvaises associations. De manière similaire, dû à leur
nature non ionique, une hybridation des bases liées à ces
squelettes est relativement non sensible aux concentrations
salines.
30 Des acides nucléiques peuvent être simple brin ou double brin,
comme spécifié, ou contenir des portions à la fois de séquence
double brin ou simple brin. L'acide nucléique peut être de
l'ADN, à la fois génomique et de l'ADN c, de 1 'ARN ou un
hybride, où 1'acide nucléique contient toute combinaison de
35 désoxyribo- et ribo-nucléotide, et toute combinaison de base,
y compris l'uracile, l'adénine, la thymine, la cytosine, la
guanine, l'inosine, la xanthine hypoxanthine, 1'isocytosine et22
1'isoguanine, etc. Un mode de réalisation préféré utilise
1'isocytosine et 1'isoguanine dans les acides nucléiques
désignés pour être complémentaires à d'autres sondes, plutôt
qu'à des séquences cibles, comme cela réduit l'hybridation non
5 spécifique, comme il est décrit généralement dans le brevet
des Etats-Unis N° 5 681 702. Comme utilisé ici, le terme
"nucleoside" inclut les nucleotides autant que les analogues
de nucleoside et nucleotide, et les nucleosides modifiés comme
les nucleosides amino modifiés. De plus, "nucleoside" inclut
10 des structures analogues non naturelles. Ainsi par exemple les
unités individuelles d'acide nucléique peptidique, chacun
contenant une base, sont référencées ici comme nucleoside.
Dans un mode de réalisation préféré, les procédés incluent la
15 concentration de l'analyte cible dans le voisinage d'une
électrode de détection. La description des compositions de
l'électrode de détection est décrite ci-dessous. Comme
l'appréciera l'homme du métier, la concentration de départ de
l'analyte cible dans l'échantillon peut varier largement,
20 selon le type d'échantillon utilisé. En général, la
concentration de départ de l'analyte cible dans l'échantillon
est relativement basse, et les techniques préférées utilisent
des procédés qui permettent la concentration de l'analyte
cible dans le voisinage de l'électrode de détection.
25
En général, "concentration" signifie que la distance de
diffusion effective qu'une analyte cible doit parcourir pour
fixer à la surface est réduite. Dans un mode de réalisation
préféré, la concentration à, ou près de l'électrode de
30 détection est supérieure à la concentration dans l'échantillon
de départ. Cela peut être mesuré de diverses manières, y
compris directement ou indirectement comme fonction de
l'accélération de fixation. C'est-à-dire, dans un mode de
réalisation préféré, les augmentations de concentration par au
35 moins deux sont préférées, . par au moins 5 fois étant
particulièrement préférés, et les augmentations par au moins
10 fois étant spécialement préférées. Comme l'appréciera23
l'homme du métier, l'augmentation dans la concentration va
aussi dépendre de la taille de 1'échantillon de départ, et
ainsi de très grandes augmentations dans la concentration, par
exemple des augmentations par 100, 1000 et 10000 (ou plus)
5 peuvent être désirables. Quand le taux d'hybridation est
utilisé en tant qu'indication de concentration, l'augmentation
de concentration par au moins plus de deux fois de l'analyte
cible se fixant à l'électrode de détection par unité de temps
est préférée, avec par au moins 5 fois étant particulièrement
10 préférée et 1'augmentation par au moins 10 étant spécialement
préférée ; de nouveau, les augmentations supérieures peuvent
être préférables dans certains modes de réalisation.
Comme exposé brièvement ici, il existe une variété de procédés
15 de concentration convenables. Dans un mode de réalisation
préféré, la concentration est faite en utilisant
I'électrophorèse. En général, le système est décrit comme
suit. Une première électrode et une seconde électrode sont
utilisées pour générer un champ électrique pour effectuer le
20 transport, généralement un transport électrophorétique, de
l'espèce d'analyte cible, augmente sa concentration à une
électrode de détection, qui a un ligand de fixation de capture
lié de manière covalente qui va se fixer (soit directement
soit indiquer indirectement) à l'analyte cible. De cette
25 manière, la cinétique de l'analyte cible se fixant à son
ligand de capture est significativement augmentée, en
augmentant à la fois la concentration de l'analyte cible dans
le milieu entourant le ligand de capture et en réduisant la
distance le long de laquelle une molécule d'analyte cible
30 donnée doit diffuser pour trouver un ligand de fixation.
L'électrode de détection peut ou ne peut pas être la même que
la première électrode. C'est-à-dire, dans un mode de
réalisation, les électrodes utilisées pour générer les champs
35 électriques qui résultent dans le transport des analytes à
liaison 'de surface sont différentes des électrodes utilisées
pour la détection ; c'est-à-dire il y a deux sets24
d'électrodes, bien que comme 1'appréciera 1'homme du métier,
les deux sets peuvent partager les électrodes par exemple
l'électrode auxiliaire. Dans un mode de réalisation
supplémentaire, les électrodes utilisées pour le transport
5 électrophorétique et pour la détection sont les mêmes ; c'est-
à-dire qu'il y a seulement un set d'électrodes. Dans certains
modes de réalisation, l'électrode électrophorétique qui attire
l'analyte cible comprend une couche de permeation qui sert à
limiter l'accès des analytes cibles à l'électrode de surface
10 et ainsi à protéger les analytes de la dégradation
électrochimique.
Ce transport électrophorétique dans le voisinage de la sonde
de détection permet la concentration de l'analyte cible à, ou
15 près de la surface de la sonde de détection, qui contient des
ligands de fixation de capture qui vont se fixer aux analytes
cibles pour former des complexes de dosage. Dans certains
modes de réalisation, l'utilisation séquentielle ou simultanée
d'une pluralité d'électrodes d'électrophorèse permet
20 I'électrophorèse multidimensionnelle, c'est-à-dire que la
solution peut être ciblée, ou "mélangée" ou "agitée" ou dans
le voisinage de l'électrode de détection pour augmenter
d'autant plus la cinétique de fixation. Comme décrit ci-
dessous, le complexe de dosage comprend une ETM, qui est alors
25 détecté en utilisant l'électrode de détection.
Il faut aussi noter qu'un nombre d'étapes électrophorétiques
peuvent être utilisées ; par exemple, les composants du
système peuvent être ajoutés séquentiellement, avec une étape
30 d'électrophorèse après chaque addition pour transporter les
réactifs vers le bas, vers l'électrode de détection. De
manière similaire, I'électrophorèse peut être utilisée pour
effectuer des étapes de "nettoyage", dans lesquelles les
réactifs en excès (les molécules cibles non fixées ou les
35 composants de ligand de fixation extra non fixés, etc.) ou
d'autres composants de l'échantillon (par exemple les acides
nucléiques non complémentaires) sont éloignés de l'électrode25
de détection. Ainsi toute combinaison des étapes
d'électrophorèse peut être utilisée. De plus, le temps pour
les étapes électrophorétiques peut être altéré.
5 Les procédés et compositions de l'invention peuvent reposer
soit sur deux sets d'électrodes, dans lesquels un set est
utilisé pour I'électrophorèse et le second set est utilisé
pour la détection, ou une seule électrode qui fonctionne pour
effectuer 'à la fois I'électrophorèse et la détection, sont
10 généralement décrits ci-dessous.
Les exemples contenant les analytes cibles sont placées dans
un champ électrique entre au moins une première et au moins
une seconde électrodes d'électrophorèse. "Electrode", ici,
15 signifie une composition, qui, quand elle est connectée à un
système électronique, est capable de détecter un courant ou un
potentiel et de le convertir en un signal. En variante une
électrode peut être définie comme une composition qui peut
appliquer un potentiel et/ou passer des électrons à ou depuis
20 des espèces dans la solution. Ainsi, une électrode est une ETM
comme décrit ci-dessous. Les électrodes préférées sont connues
dans la technique, et incluent, mais sans s'y limiter,
certains métaux et leurs oxydes, y compris l'or ; le platine ;
le palladium, le silicium ; l'aluminium ; les électrodes en
25 oxyde de métal y compris l'oxyde de platine, l'oxyde de
titane, l'oxyde d'étain, l'oxyde d'étain indium, l'oxyde de
palladium, l'oxyde de silicium, l'oxyde d'aluminium, l'oxyde
de molybdène (M02O6) , l'oxyde de tungstène (WO3) et les oxydes
de ruthénium ; et le carbone (y compris les électrodes de
30 carbone lisses, le graphite et la pâte de carbone). Les
électrodes préférées incluent l'or, le silicium, le platine,
le carbone et les électrodes d'oxyde de métal, l'or étant
particulièrement préféré.
35 Les électrodes décrites ici sont représentées comme une
surface plane, qui est seulement l'une des conformations
possibles de l'électrode et elle est à but schématique26
uniquement. La conformation de l'électrode va varier avec le
procédé de détection utilisé. Par exemple, les électrodes
planaires plates peuvent être préférées pour les procédés de
détection optique, ou quand les rangées d'acide nucléique sont
5 faites, requérant a'insi des localisations adressables à la
fois pour la détection et la synthèse. En variante, pour des
analyses de sondage simple, l'électrode peut être sous la
forme d'un tube, avec les SAM comprenant des oligomères
conducteurs et des acides nucléiques fixés à la surface
10 interne. Les anneaux d'électrode ou les électrodes en forme de
grillage peuvent aussi être préférés dans certains modes de
réalisation. Cela permet à un maximum de zones de surface
contenant les acides nucléiques d'être exposées à un petit
volume d'échantillon.
15
Comme l'appréciera l'homme du métier, les électrodes sont
configurées dans une variété de moyens différents. Dans un
mode de réalisation préféré, les électrodes peuvent être
interdigitallisées comme il est connu dans la technique. De
20 plus, les différentes électrodes (par exemple les électrodes
de détection et les électrodes d'électrophorèse) peuvent être
d'un même métal ou d'un métal différent ; par exemple les
électrodes d'électrophorèse peuvent être en platine et les
électrodes de détection en or.
25
30
De plus, comme il est expliqué plus en détail ci-dessous,
l'électrode de détection peut être configurée pour maximiser
le contact entre l'échantillon entier et l'électrode, ou pour
permettre le mélange, etc.
Dans un mode de réalisation préféré, l'une (ou les deux) des
électrodes électrophorétiques, ou les canaux dans le substrat,
comprend une couche de permeation, comme il est décrit
généralement dans les brevets des Etats-Unis N° 5 632 957 et 5
35 605 662, les deux étant expressément incorporés à titre de
référence dans leur globalité. Ceci est particulièrement utile
quand le système fonctionne à hauts voltages, c'est-à-dire27
lorsque l'hydrolyse de l'eau a lieu. La couche de permeation
sert comme couche de diffusion intermédiaire, et a
généralement une propriété de limite de corps qui inhibe ou
empêche tout contact? physique entre les analytes cibles, les
5 réactifs, etc. et 'l'électrode de surface et ainsi protège
contre les , effets électrochimiques adverses. La couche de
permeation peut être formée d'une variété de matériaux, y
compris mais sans s ' y limiter, des polymères de chaîne de
carbone, des polymères de chaîne de carbone-silicium, des
10 polymères de chaîne de carbone-phosphore, des polymères de
chaîne de carbone-azote, des polymères de chaîne de silicium,
des alliages de polymère, des composites de polymère en
couche, des matériaux de polymère interpénétrants, des
céramiques, des verres à porosité contrôlée, des matériaux
15 formés comme des sol-gels, des matériaux formés comme des
aérogels, de 1'agarose, des acrylamides, du matériau formé
comme des hydrogels, du graphite poreux, de l'argile ou des
zeolites. Sont particulièrement préférés les polymères en
forme de grillage formés d'acrylamide et de lieurs croisés,
20 incluant, mais sans s'y limiter, du diacrylate de
triéthylèneglycol, du diacrylate de tétraéthylèneglycol et du
N-N'-méthylène-bisacryiamide.
Dans un mode de réalisation préféré, les électrodes
25 d'électrophorèse et/ou les canaux comprennent des matériaux
qui ne sont pas des matériaux de couche de permeation
traditionnelles mais sont plutôt des matériaux conducteurs,
particulièrement des polymères électropolymérisables. Dans ce
mode de réalisation, les électrodes d'électrophorèse sont
30 fabriquées en polymèrisant un polymère sur la surface de
l'électrode d'électrophorèse. Un avantage de ces matières
électropolymérisables est que l'épaisseur du matériau
polymérisé peut être à la fois contrôlée et variée ; par
exemple, une couche monomoléculaire simple de matériau peut
35 être faite, ou des couches jusqu'à plusieurs microns
d'épaisseur peuvent être faites. De plus, il est possible de28
localiser très spécifiquement le polymère sur la surface de
l'électrode d'électrophorèse.
Des monomères électropolymérisables convenables incluent, mais
5 n'y sont pas limités, à des pyrroles (pour résulter en une
couche de polypyrrole ; voir Brajter-Toth, Anal Chem. 66:2458-
2464 (1994), l'aniline (pour résulter en une couche de
polyaniline), du phénol (pour résulter en une couche de
polyphenol') , des azulènes, des pyrènes et des carbazoles (voir
10 Hino et al.. Synthetic Metals 64:259 (1994). Un matériau
particulièrement préféré est le polypyrrole, du fait qu'il ait
quelques propriétés intéressantes en ce qui concerne la
conductivité. La sur-oxydation du pyrrole peut transformer le
polymère conducteur en un isolateur qui a des caractéristiques
15 de reconnaissance moléculaire.
Dans un mode de réalisation préféré, on peut utiliser soit des
membranes de séparation d'ions soit des composants sol-gel
pour protéger les électrodes d'électrophorèse. Voir Anal.
20 Chem., 72:1835 (2000). Dans ce mode de réalisation, les acides
nucléiques (ou autres analytes cibles) peuvent en fait entrer
dans la membrane ou le gel (par exemple ils sont piégés ou
collectés) . De plus, cela peut être suivi par une étape
d'échange de tampon.
25
Le champ électrique est généré entre la première et la seconde
électrodes d'électrophorèse. Les termes "première" et
"seconde" sont essentiellement interchangeables et ne
signifient pas qu'ils confèrent toute distinction spatiale ou
30 conforme, bien qu'en général, tel qu'utilisée ici, la première
électrode est généralement l'électrode la plus proche
spatialement parlant de l'électrode de détection (quand deux
sets d'électrodes sont utilisés), ou alternativement, la
première électrode est généralement représentée comme
35 1'électrode de détection (quand seulement un set d'électrode
est utilisé). Comme l'appréciera l'homme du métier, on peut
utiliser n'importe quel nombre de configurations d'électrodes29
d'électrophorèse possible, comme il est généralement
représenté sur les figures 1, 2 et 15. En général, il y a deux
types de configurations : I'électrophorèse de masse et
1'électrophorèse ciblée.
5
Dans un mpde de réalisation préféré, une configuration
d'électrophorèse de masse est utilisée. C'est-à-dire, qu'un
set d'électrodes d'électrophorèse est utilisé, comme le
montrent généralement les figures IA, IB et IC. La première
10 électrode d'électrophorèse (10 sur la figure 1) est
généralement plus grosse que les électrodes de détection et
elle est arrangée spatialement de manière à ce que les sondes
de détection se trouvent à l'intérieur du champ électrique
généré par les électrodes d'électrophorèse. Par l'application
15 d'un voltage DC entre les électrodes, un champ électrique est
généré de manière à ce que le transport électrophorétique des
analytes cibles chargées dans le voisinage des sondes de
détection soit effectué. Alors que cela ne place pas
nécessairement directement les analytes cibles sur les sondes
20 de détection, la réduction de la distance de diffusion
effective et l'augmentation de la concentration effective à la
surface de détection augmentent significativement la cinétique
de la fixation de l'analyte cible au ligand de fixation de
capture sur la surface de la sonde de détection, comme la
25 diffusion doit avoir lieu dans deux dimensions
essentiellement, plutôt que dans trois.
Dans un mode de réalisation préféré, une configuration
d'électrophorèse ciblée est utilisée, comme le représentent
30 généralement les figures ID, IE et IF. Dans ce mode de
réalisation, il y a une pluralité d'électrodes
d'électrophorèse qui sont utilisées pour cibler spécifiquement
l'analyte à une électrode de détection spécifique, plus
généralement, mais pas toujours, dans des sets. Cela peut être
35 effectué par un moyen basique sur deux. Dans un mode de
réalisation préféré, comme représenté généralement sur la
figure IF et les composants de laquelle étant décrit dans le30
brevet des Etats-Unis N° 5 605 662, chaque électrode de
détection a une électrode d'électrophorèse associée. Ainsi, en
appliquant soit séquentiellement soit simultanément un voltage
entre les sets d'électrodes d'électrophorèse, les analytes
5 cibles peuvent être' déplacées d'une électrode de détection à
une autre. ?En considérant pour le moment une analyte cible
chargée négativement comme un acide nucléique, le système peut
fonctionner comme suit, en utilisant le système de la figure
IF. Dans 'un mode de réalisation, un champ électrique est
10 généré entre l'anode 50 et l'électrode d'électrophorèse 10 qui
agit comme la cathode, pour faire' descendre le mélange
d'analyte cible anionique vers à laJ fois l'électrode
d'électrophorèse 10 et ainsi l'électrode de détection 20, où
la fixation de l'espèce du mélange d'analyte cible peut avoir
15 lieu. Le champ électrique est alors éteint, et un nouveau
champ électrique est appliqué entre l'électrode
d'électrophorèse 10, agissant maintenant comme une anode, et
l'électrode d'électrophorèse 11 agissant comme une cathode.
Cela conduit des espèces anioniques non fixées de 10 à 11, où
20 la fixation d'une seconde espèce d'analyte cible peut avoir
lieu. Le champ électrique est éteint, et un nouveau champ tel
qu'entre 11 (agissant comme l'anode) et 12 (agissant comme la
cathode) est généré, pour déplacer les analytes cibles non
fixées vers une nouvelle électrode de détection, etc.
25 L'avantage de ce type d'approche est qu'essentiellement la
population d'analytes cibles entière est transportée vers
chaque ligand de capture, maximisant ainsi le nombre
d'analytes cibles qui ont une opportunité pour se fixer à leur
ligand de capture.
30
En variante, I'électrophorèse sur chaque bloc peut fonctionner
simultanément, avec un champ électrique généré entre (en
considérant une population d'analytes cibles chargées
négativement) une anode 50 et des cathodes 10, 11, 12 et 13.
35 Ceci est plus rapide, mais résulte (en considérant quatre
blocs) dans seulement un quart de l'analyte cible "présenté" à
chaque électrode de détection. Ceci peut être ou peut ne pas31
être désirable dans certains modes de réalisation ; par
exemple, quand la vitesse est plus importante que la
sensibilité.
5 Dans un mode de réaïisation préféré, une électrophorèse ciblée
apparentée mais d'un type différent est effectuée. Dans ce
mode de réalisation, une pluralité de sets d'électrodes
d'électrophorèse est positionnée d'une manière
tridimensionnelle, pour permettre le mouvement des analytes
10 cibles vers différentes localisations. Par exemple, comme le
montre la figure 2, l'utilisation d'une rangée
tridimensionnelle d'électrodes d'électrophorèse permet la
localisation de solutions d'échantillons à des localisations
particulières, c'est-à-dire des électrodes de détection
15 individuelles ou des sets d'électrodes de détection. Ainsi,
par exemple, en référence à la figure 2, le voltage
électrophorétique appliqué entre les électrodes
d'électrophorèse 10 et 15 et, au même moment, les électrodes
d'électrophorèse 12 et 17 peut conduire l'analyte cible vers
20 l'électrode de détection 20.
En variante, dans un mode de réalisation préféré, une
pluralité d'électrodes d'électrophorèse est utilisée, non pour
cibler spécifiquement vers une localisation particulière, mais
25 plutôt pour augmenter la cinétique de fixation au travers du
"mélange" ou "agitation" de l'échantillon dans le voisinage de
l'électrode de détection avec son ligand de capture associé.
Par exemple, comme montré sur la figure 2, une étape
d'électrophorèse initiale peut être effectuée entre
30 1'électrode électrophorétique 18 et une seconde électrode
électrophorétique non représentée, pour conduire les analytes
cibles à la surface de la sonde de détection, c'est-à-dire
"une électrophorèse de masse" comme défini ci-dessus. Puis,
des voltages, l'un ou l'autre des voltages DC ou AC,
35 comprenant des impulsions de chaque, peuvent être appliqués
entre les sets supplémentaires d'électrodes d'électrophorèse,
pour transporter l'analyte cible pour augmenter à la fois la32
disponibilité et la cinétique de fixation des analytes cibles
pour la capture des ligands de fixation immobilisés sur les
électrodes de détection. De manière similaire, comme le montre
la figure 15E, une- utilisation de deux sets d'électrodes
5 d'électrophorèse à 'des moments différents peut conduire les
analytes cibles vers la surface de la sonde de détection.
La force du champ électrique appliqué est déterminée par un
certain nombre de facteurs, y compris, mais sans s'y limiter,
10 le temps d'électrophorèse désiré, la taille de l'échantillon
(c'est-à-dire la distance que l'analyte cible doit parcourir),
la composition de la solution (c'est-à-dire la présence ou
l'absence de transporteurs de charges électroactives et leurs
potentiels redox), la composition des composants (c'est-à-dire
15 la stabilité de certains composants de l'invention au
potentiel électrochimique), la présence ou l'absence de
transporteurs de charge électroactive dans la solution, la
taille de la chambre, la charge de 1'analyte cible, la taille
et la localisation des électrodes, le matériau de l'électrode,
20 etc.
En général, les voltages DC sont appliqués pour
1'électrophorèse initiale, les impulsions DC ou AC ou les
champs étant appliqués pour le mélange, si applicables.
25
La force du champ appliqué va dépendre en partie des autres
composants du système. Par exemple, quand seulement un set
d'électrodes et utilisé et des liaisons thiol sont utilisées
pour lier les composants du système aux électrodes de
30 détection (c'est-à-dire la liaison d'agents de passivation et
d'oligomères conducteurs à l'électrode de détection, comme il
est expliqué ci-dessus de manière plus précise), le voltage
électrophorétique appliqué est inférieur au potentiel
d'oxydation des composés thiol, c'est-à-dire généralement
35 moins d'1 V. En variante, des voltages supérieurs peuvent être
utilisés?lorsque des liaisons thiol ne sont pas utilisées. De
manière similaire, les liaisons thiol sont acceptables à des33
forces de champ supérieures lorsque deux sets d'électrodes
sont utilisés, c'est-à-dire que les électrodes de détection
contenant de la chimie fine ne sont pas exposées à de hauts
voltages.
5
Ainsi, en général, les voltages électrophorétiques vont de lmV
à environ 2V, bien que comme l'appréciera l'homme du métier,
le voltage requis va dépendre du temps de fonctionnement
désiré, de' la charge nette des analytes, de la présence ou de
10 1 ' absence de tampons, de la position des électrodes, etc.
Comme il est connu dans la technique, la vitesse
électrophorétique est u(d3>/dx), où p. est la mobilité ionique.
Pour un set de mode de réalisation d'électrode, les voltages
électrophorétiques vont d'environ 50 mV à environ 900 mV,
15 sachant que de 100 mV à environ 800 mV est le voltage préféré,
et de 250 mV à environ 700 mV étant le voltage spécialement
préféré. Pour deux modes de réalisation de sets, les voltages
électrophorétiques vont d'environ 100 mV à environ 2 V ou
plus, les voltages d'environ 500 mV à environ 1,5 V étant
20 préférés, et les voltages de environ 1 V à environ 1,5 V étant
spécialement préférés. Bien sûr, comme l'appréciera l'homme du
métier, ces voltages peuvent être positifs ou négatifs, selon
la charge de l'analyte.
25 Lorsque l'on utilise des voltages faibles, c'est-à-dire des
voltages inférieurs à 1,23 V (relatifs à une électrode
d'hydrogène normal), le voltage auquel l'hydrolyse de l'eau a
lieu, il est nécessaire d'inclure une espèce électroactive
dans la solution, de manière à ce que le courant puisse être
30 transporté de l'électrode à la solution et qu'un champ
électrique puisse être généré au travers de la solution. Le
type et la concentration de l'espèce électroactive ont varié
avec le voltage, la longueur du temps requis pour
I'électrophorèse (se rapporte à la distance requise, c'est-à-
35 dire au volume de l'échantillon), etc. Dans un mode de
réalisation préféré, le potentiel redox de 1'espèce
électroactive est supérieur à celui de l'ETM utilisée pour la34
détection. Par exemple, si un transporteur de charges
électroactives avec un potentiel redox de 300 mV est utilisé
et que l'ETM a un potentiel redox de 100 mV, l'électrophorèse
peut être effectuée à 300 mV, la détection ultérieure étant
5 effectuée à 100 mV, sans nécessiter d'enlever l'espèce
radioactive..
Comme l'appréciera l'homme du métier, une large variété de
transporteurs de charges électroactives convenables peut être
10 utilisée, incluant, mais sans s'y limiter, des composants de
fer, y compris FeCl aqueux, Fe (CN) e4_/'3^ , et le ferrocene et
ses dérivés ; les complexes de ruthénium incluant Ru (NH3) spyr
et Ru (NH3) 5H2O ; les complexes de cobalt incluant Co (NH3) $3+,
Co(bpy)33+ et Co (tris) bpy3+ ; les complexes d'osmium incluant
15 Os(bpy)32+ et Os (tris) bpy et dérivés ; les complexes de
rhénium, incluant Rh(NH3)4Cl2 ; et 1'iodine 13-. Comme il est
connu dans la technique, certaines réactions oxydation-
réduction produisent des solides (c'est-à-dire que ce ne sont
pas des couples réversibles). Généralement, ces espèces ne
20 sont pas préférées, bien que dans certains exemples elles
peuvent être utilisées quand 1'électrode de détection est la
réaction soluble. Ainsi, par exemple, une réaction Ag/AgCl
peut être utilisée avec les acides nucléiques, comme la
réaction AgCl a lieu à l'anode. La concentration de la
25 molécule redox va varier, comme l'appréciera l'homme du
métier, les concentrations à saturation ou en dessous de
celle-ci étant utiles. Il faudrait aussi noter que dans ce
mode de réalisation, quand un transporteur de charges
électroactives est utilisé, il peut être nécessaire de
30 mélanger ou de remuer le système au cours de I'électrophorèse.
Il devrait être noté que les transporteurs de charge
électroactive peuvent être utilisés dans n'importe quel
système, particulièrement le système basé sur des gammes, qui
35 utilise 1'électrophorèse. Par exemple, les transporteurs de
charge électroactive peuvent être utilisés dans les systèmes
de gammes électrophorétiques comme décrit dans les brevets des35
Etats-Unis N° 5 532 129, 5 605 662, 5 565 322 et 5 632 957 et
les applications connexes.
L'échantillon est placé dans le champ électrique pour
5 effectuer le transport électrophorétique vers une ou plusieurs
électrodes ^de détection. La composition de l'électrode de
détection est telle que décrite ci-dessus pour les électrodes
d'électrophorèse, les électrodes en or, en silicium, en
carbone, ' en platine et en oxyde de métal étant
10 particulièrement préférées.
Dans un mode de réalisation préféré, les électrodes de
détection sont formées sur un substrat. De plus, la discussion
ici est généralement dirigée vers la formation d'électrodes en
15 or, mais comme l'appréciera l'homme du métier, d'autres
électrodes peuvent aussi être utilisées. Le substrat peut
comprendre une large variété de matériaux , comme 1'appréciera
l'homme du métier, de manière particulièrement préférée les
matériaux à cartes à circuit imprimé(PCB). Ainsi, en général,
20 les substrats convenables incluent, mais sans s'y limiter, la
fibre de verre, le téflon, la céramique, le verre, le
silicium, le mica, le plastique (y compris l'acrylique, le
polystyrène et les copolymères de styrène et autres matières),
le polypropylene, le polyethylene, le polybutylène, le
25 polycarbonate, les polyuréthanes, la Téfon? et des dérivés de
ceux-ci, etc.), GETEK (un mélange d'oxyde de polypropylene et
de fibres de verre), etc.
En général, les matériaux préférés incluent les matériaux à
30 cartes à circuit imprimé. Les matériaux à circuit imprimé sont
ceux qui comprennent un substrat isolant qui est recouvert
d'une couche conductrice et traité en utilisant des techniques
de lithographie, particulièrement des techniques de
photolithographie, pour former les modèles d'électrodes et les
35 raccords (auxquels on fait parfois référence dans la technique
sous le nom d'interconnexions ou conducteurs). Le substrat
isolateur est généralement, mais pas toujours, en polymère.36
Comme il est connu dans la technique, une ou plusieurs couches
peuvent être utilisées, pour faire des cartes soit "deux
dimensions" (par exemple toutes les électrodes et les
interconnexions dans, un plan) ou "tridimensionnels" (dans
5 lesquels les électrodes sont sur une surface et les raccords
peuvent passer à travers le carte vers l'autre côté). Les
systèmes tridimensionnels reposent fréquemment sur
l'utilisation de forage ou de gravage, suivis d'un dépôt
électrolytique avec un métal comme le cuivre, de manière à ce
10 que les interconnexions "au travers du carte" soient
effectuées. Les matériaux de circuit imprimé sont souvent
fournis avec un emballage déjà lié au substrat, comme un film
de cuivre, le cuivre supplémentaire étant ajouté si nécessaire
(par exemple pour les interconnexions) par exemple par dépôt
15 électrolytique. Il peut alors être nécessaire de rendre la
surface de cuivre rugueuse, par exemple par gravure, pour
permettre la liaison de la couche d'adhésion.
Dans certains modes de réalisation, le verre peut ne pas être
20 préféré comme substrat.
En conséquence, dans un mode de réalisation préféré, la
présente invention fournit des biopuces (auxquelles on fait
parfois référence ici sous le terme "puces") qui comprennent
25 des substrats comprenant une pluralité d'électrodes, de
préférence des électrodes en or. Le nombre d'électrodes est
tel qu'expliqué brièvement pour les gammes. Chaque électrode
comprend de préférence une couche monomoléculaire auto-
assemblée comme expliqué brièvement ici. Dans un mode de
30 réalisation préféré, l'une des espèces formant la couche
monomoléculaire comprend un ligand de capture comme expliqué
brièvement ici. De plus, chaque électrode a une
interconnexion, qui est liée à l'électrode à un bout et en fin
de compte attachée au système qui peut contrôler 1'électrode.
35 C'est-à-dire, que chaque électrode est indépendamment
adressable.37
Les substrats peuvent faire partie d'un système plus grand
comprenant une chambre de détection qui expose un volume donné
d'échantillon à l'électrode de détection. Généralement la
chambre de détection va d'environ à 1 nL à 1 ml, de préférence
5 d'environ 10 uL à/ 500 uL. Comme l'appréciera l'homme du
métier, selon les conditions expérimentales et le dosage, des
volumes plus petits ou plus grands peuvent être utilisés.
Dans certains modes de réalisation, la chambre de détection et
10 l'électrode font partie d'une cellule qui peut être placée
dans un système comprenant des composants électroniques
(source de voltage AC/DECRIT, un ampèremètre, une unité
centrale, un affichage visuel, un contrôleur de température,
une source de lumière, etc.). Dans ce mode de réalisation, les
15 interconnexions depuis chaque électrode sont positionnées de
manière à ce que sur 1 ' insertion de la cellule dans le
système, les connexions entre les électrodes et les composants
électroniques soient établies.
20 Les électrodes de détection sur le matériau de circuit imprimé
(ou autres substrats) sont généralement préparées selon une
très grande variété de moyens. En général, l'or de haute
pureté est utilisé, et il peut être déposé sur une surface par
l'intermédiaire des processus de déposition sous vide
25 (crachotement et evaporation) ou déposition de solution (dépôt
électrolytique ou processus moins électriques). Quand dépôt
électrolytique est effectuée, le substrat doit initialement
comprendre un matériau conducteur ; des cartes de circuit
imprimé en fibres de verre sont fréquemment fournis avec des
30 feuilles de cuivre. Fréquemment, selon le substrat, une couche
d'adhésion entre le substrat et l'or afin d'assurer la bonne
stabilité mécanisme est utilisée. Ainsi, les modes de
réalisation préférés utilisent une couche de déposition d'un
métal d'adhésion comme le chrome, le titane, le
35 titane/tungstène, le tantale, le nickel ou le palladium, qui
peut être déposée comme ci-dessus pour l'or. Quand le métal
dépôt électrolytique (soit le métal d'adhésion soit le métal38
de l'électrode) est utilisé, ces additifs affinant le grain,
auquel on fait fréquemment référence dans le commerce sous le
terme de brillanteurs, peuvent être optionnellement ajoutés
pour changer les propriétés de déposition de surface. Les
5 brillanteurs préfères sont les mélanges d'espèces organiques
et inorganiques, de manière préférée le cobalt et le nickel.
En général, la couche d'adhésion a une épaisseur d'environ
100 Â à environ 25 microns (1000 micropouces). Si le métal
10 d'adhésion est électrochimiquement actif, le métal de
l'électrode doit être recouvert avec une épaisseur qui empêche
"l'infiltration" ; si le métal d'adhésion n'est pas
électrochimiquement actif, le métal de 1'électrode peut être
plus fin. Généralement, le métal de l'électrode (de préférence
15 l'or) est déposé à une épaisseur allant d'environ 500 Â à
environ 5 microns (200 micropouces) avec une préférence pour
les épaisseurs allant d'environ 30 micropouces à environ 50
micropouces. En général, l'or est déposé pour faire des
électrodes allant d'une taille d'environ 5 microns à environ 5
20 mm de diamètre, avec une préférence pour les tailles allant
d'environ 100 à 250 microns. Les électrodes de détection ainsi
formées sont alors de préférence nettoyées et les SAM ajoutés,
comme discuté ci-dessous.
25 Ainsi, la présente invention fournit des procédés pour faire
un substrat comprenant une pluralité d'électrodes en or. Les
procédés comprennent tout d'abord le revêtement d'un métal
d'adhésion, comme le nickel ou le palladium (optionnellement
avec des brillanteurs), sur le substrat. Le dépôt
30 électrolytique est préféré. Le métal de l'électrode, de
préférence de l'or, est alors placé (à nouveau, le dépôt
électrolytique est préféré) sur le métal d'adhésion pour le
recouvrir. Les modèles du système, comprenant les électrodes
et leurs interconnexions associées sont alors créés en
35 utilisant des techniques lithographiques, particulièrement des
techniques photolithographiques telles qu'elles sont connues
dans la technique, et par gravure chimique humide.39
35
Fréquemment, un matériau isolateur résistant chimiquement non
conducteur comme un masque de soudure ou du plastique est
appliqué en utilisant ces techniques photolithographiques,
laissant seulement les électrodes et le point de connexion au
5 conducteur exposés ; les conducteurs eux-mêmes sont
généralement recouverts.
Les procédés continuent avec l'addition de SAM. Dans un mode
de réalisation préféré, les techniques de déposition de
10 gouttes sont utilisées pour ajouter la chimie requise, c'est-
à-dire des espèces de formation de couches monomoléculaires,
l'une desquelles étant de préférence un ligand de capture
comprenant des espèces. Les techniques de déposition de
gouttes sont bien connues pour faire des gammes "taches". Ceci
15 est fait pour ajouter une composition différente à chaque
électrode, c'est-à-dire pour faire une gamme comprenant
différents ligands de capture. Alternativement, les espèces
SAM peuvent être identiques pour chaque électrode, et cela
peut être accompli en utilisant une technique de déposition de
20 gouttes ou l'immersion du substrat entier ou une surface du
substrat dans la solution.
Dans un mode de réalisation préféré, le système est configuré
pour maximiser le flux de l'échantillon devant les électrodes
25 de détection. Comme généralement représenté sur la figure 15,
il existe une variété de moyens pour permettre ceci. Dans un
mode de réalisation préféré, les électrodes de détection sont
réparties sur un substrat qui a des canaux ou des pores à
l'intérieur (on peut aussi y faire référence ici sous les
30 termes de trous ou de voies). Les électrodes d'électrophorèse
sont positionnées sur les côtés opposés de ce substrat.
L'introduction du champ électrique résulte dans le drainage de
l'échantillon à travers ou devant l'électrode de détection, ce
qui résulte en une meilleure cinétique d'hybridation.
Comme l'appréciera l'homme du métier, la configuration des
électrodes d'électrophorèse peut varier. Dans un mode de40
réalisation préféré, les électrodes de détection et au moins
une électrode d'électrophorèse sont positionnées sur la
première surface du substrat, et au moins une seconde
électrode d'électrophorèse est sur la seconde surface du
5 substrat (en considérant un substrat généralement planaire ;
comme l'appréciera l'homme du métier, d'autres configurations
sont aussi possibles).En variante, les surfaces de la chambre
de détection peuvent comprendre les électrodes
d'électrophorèse ; c'est-à-dire, qu'il est possible de
10 positionner ces électrodes hors du substrat mais sur
différents côtés du substrat. En" outre, une pluralité
d'électrodes d'électrophorèse peut être utilisée, comme il est
généralement expliqué brièvement ici.
15 Dans un mode de réalisation, ces canaux sont remplis par un
matériau qui permet les passages des ions pour effectuer
I'électrophorèse, mais qui ne permet pas le passage de
l'analyte cible. Par exemple, les canaux peuvent être remplis
par un matériau de couche de permeation comme défini ici.
20
Dans un mode de réalisation préféré, plutôt que d'utiliser un
matériau comme du gel, une membrane est placée sur 1'un ou sur
les deux bouts du canal. Cette membrane permet de préférence
le mouvement des ions pour effectuer I'électrophorèse, mais ne
25 laisse pas passer les analytes cibles au travers, concentrant
alors les analytes cibles dans le voisinage des électrodes de
détection.
Dans un mode de réalisation préféré, l'accélération
30 d'hybridation est accomplie en utilisant une combinaison de la
configuration du système et d ' un moteur absorbant. Dans ce
mode de réalisation, représenté généralement sur la figure 6,
la chambre de détection a deux sous-chambres, généralement
séparées par une séparation par exclusion de taille comme une
35 matrice de gel ou une membrane. Une chambre comprend le port
d'arrivée de l'introduction de l'échantillon et comprend
l'électrode de détection. L'autre chambre comprend un matériau41
absorbant, habituellement sec, qui peut absorber la solution
aqueuse de l'échantillon (bien que dans certains cas,
1'échantillon peut être dans une phase organique et le
matériau absorbant va absorber les solutions de la phase
5 organique). '
Ainsi, dans un mode de réalisation préféré, une séparation par
exclusion de taille est utilisée. Par "séparation par
exclusion de taille" on entend ici un matériau qui exclut les
10 composants sur la base de leur poids moléculaire. Ainsi, par
exemple, les matrices de gel (comme ? brièvement expliqué ici
dans les couches de permeation, comme l'acrylamide, l'agarose,
etc.) ou des membranes de limites d'exclusion par taille
telles qu'elles sont connues dans la technique sont utilisées.
15 Dans certains modes de réalisation, particulièrement quand
l'analyte cible a un fort poids moléculaire comparé aux autres
composants contaminants du système, la limite de poids
moléculaire de la membrane ou du gel peut être choisie pour
effectuer aussi une étape de réduction de complexité. C'est-à-
20 dire, quand par exemple un ARN ribosomal est l'analyte cible,
la séparation par exclusion qui permet le passage d'un ARNm
moyen peut être utilisée. De manière similaire, quand la cible
comprend un gros ADN génomique, les limites de poids
moléculaire qui permettent le passage de l'ARNm et l'ADN
25 fragmenté doivent être utilisées.
Dans ce mode de réalisation, sur l'introduction de
l'échantillon, la solution aqueuse qui contient l'analyte
cible est retirée de la chambre de détection comprenant
30 1'électrode de détection pour aller dans la chambre
d'absorption, pendant la concentration de l'analyte cible dans
la chambre de détection. Ainsi, par exemple, une injection de
1 ml d'échantillon dans une cellule comprenant une chambre
d'absorption de 0,95 ml va concentrer l'analyte cible de 20:1
35 dans la chambre de détection.42
Dans un mode de réalisation préféré, la chambre de détection
et la chambre d'absorption sont séparées par des trous ou des
voies dans le substrat comprenant les électrodes, bien que
dans certains modes de réalisation il est possible d'avoir les
5 électrodes de détection "sur" la séparation par exclusion de
taille.
Dans ce mode de réalisation, il peut être souhaitable
d'ajuster 'les volumes de chaque chambre dans la cellule pour
10 permettre une absorption facile. C'est-à-dire que lorsque le
volume de la chambre de détection est le même ou inférieur à
celui du volume de l'échantillon, l'injection d'échantillons
dans la chambre peut ne pas résulter en 1 ' absorption quand le
matériau absorbant est dans l'état sec et stocké. Cependant,
15 si le volume d'échantillon est légèrement supérieur à celui du
volume de la chambre de détection, l'injection de
l'échantillon dans la chambre séparée peut forcer
"l'humidification" du matériau absorbant, conduisant ainsi la
réaction à travers l'action capillaire. Ainsi, dans un mode de
20 réalisation préféré, le volume de la chambre de détection est
légèrement inférieur au volume de l'échantillon, de manière à
ce que le fluide soit "forcé" à aller dans la chambre
d'absorption.
25 De plus, l'utilisation d'une séparation par exclusion de
taille permet aussi une accélération de l'hybridation basée
sur un volume d'échantillon. C'est-à-dire qu'en utilisant une
séparation par exclusion de taille comme avec une membrane ou
une matrice de gel, un grand volume d'échantillon peut être
30 introduit dans la chambre de détection, la solution aqueuse
étant forcée de passer à travers la séparation par exclusion
de taille dans la chambre d'absorption. Ainsi, par exemple, si
le volume d'échantillon est 5 ml et le volume de la chambre de
détection est 1 ml et la chambre d'absorption est 4 ml, une
35 concentration multipliée par 5 d'analyte cible dans le volume
de l'échantillon est obtenue. Comme l'appréciera l'homme du
métier, ceci peut être fait avec ou sans matériau d'absorption43
dans la chambre d'absorption. Ce qui est important dans ce
mode de réalisation est que la séparation par exclusion de
taille empêche l'analyte cible de quitter le voisinage de
l'électrode de détection. De plus, dans certains modes de
5 réalisation, le volume de la chambre d'échantillon peut être
ajustable ;t c'est-à-dire que, sur l'introduction de
l'échantillon, la chambre de l'échantillon est suffisamment
grande pour contenir l'échantillon entier. Cependant, comme la
solution dé 1 'échantillon est "tirée" vers 1'intérieur de la
10 chambre d'absorption, le volume de la chambre d'échantillon se
réduit, par exemple par 1'utilisation d'une membrane ou d'une
fermeture flexible. De cette manière, l'analyte^ cible
concentrée est maintenue dans le voisinage de l'électrode de
détection.
15
Comme l'appréciera l'homme du métier, le système peut accepter
nombre de configurations, comme représenté généralement sur la
figure 16.
20 Du mode de réalisation préféré, le matériau absorbant peut
être utilisé conjointement avec 1'électrophorèse. C'est-à-dire
que, comme généralement représenté sur la figure 16, il existe
un nombre de configurations qui peuvent être utilisées y
compris des configurations "de mélange" comme expliqué
25 brièvement ici.
De plus, comme représenté sur la figure 13B, le système peut
être configuré pour permettre à l'échantillon de circuler
devant un certain nombre d'électrodes de détection placées le
30 long du canal de I'électrophorèse. C'est-à-dire que, comme
expliqué brièvement ici, l'échantillon recevant la chambre
peut être configuré pour permettre à autant d'échantillons que
possible d'entrer en contact avec les électrodes de détection.
35 De manière similaire, quand un système à deux électrodes est
utilisé, un mode de réalisation préféré utilise une électrode
de détection poreuse positionnée entre la première et la44
seconde électrodes d'électrophorèse, de manière à ce que la
cible soit obligée de "passer à travers" l'électrode de
détection, et ainsi on maximise le contact de 1 'analyte cible
avec 1'électrode de détection. Par exemple, les membranes
5 microporeuses de ' polycarbonate sont recouvertes par
crachotement d'or pour l'analyse au microscope électronique.
En variante, on peut utiliser de la polyaniline recouverte
d'or. Ainsi, les électrodes en or ayant des tailles de pore
très uniformes, allant de 0,01 à 20 pm peuvent être créées. De
10 manière similaire, des tranches de silicium avec des pores de
10 um ont été développées pour être utilisées comme un
génocapteur qui permette la capture de la séquence cible 700
fois. En ajustant le débit, la zone des blocs, le diamètre de
pore, la profondeur, et les paramètres électrophorétiques,
15 pratiquement 100 % de l'analyte cible dans l'échantillon peut
être fixé à l'électrode de détection.
11 devrait aussi être noté qu'un certain nombres d'étapes
électrophorétiques peuvent être utilisées ; par exemple, les
20 composants du système peuvent être ajoutés séquentiellement,
avec une étape d'électrophorèse après chaque rajout pour
transporter les réactifs vers l'électrode de détection en bas.
De manière similaire, I'électrophorèse peut être utilisée pour
effectuer les étapes de "nettoyage", pendant lesquelles les
25 réactifs en excès (les molécules cibles non fixées ou les
composants de liants d'extra fixation non fixés, etc.) sont
éloignés de l'électrode de détection. Ainsi toute combinaison
d'étapes d'électrophorèse peut être utilisée. En outre, la
durée des étapes d'electrophoreses peut être changée.
30
En outre, comme expliqué brièvement ici, les étapes
d'électrophorèse peuvent être combinées avec d'autres
techniques pour concentrer les analytes à la surface de
1'électrode de détection. Par exemple, comme montré sur la
35 figure 13, le système peut être configuré pour permettre le
passage de l'échantillon devant l'électrode de détection dans
une direction, couplé avec une circulation électrophorétique45
10
dans la direction opposée, concentrant ainsi efficacement
l'analyte cible et permettant en même temps à d'autres
composants de l'échantillon (en particulier les composants non
chargés ou les composants ayant une charge opposée à
l'analyte) d'être é'vacués. Dans ce mode de réalisation, la
force du champ électrophorétique est ajustée en se basant sur
la taille et la charge de la cible, de manière à ce que la
cible reste relativement immobilisée au niveau de l'électrode
de détection.
De plus, comme l'appréciera l'homme du métier, il est aussi
possible de configurer la chambre recevant l'échantillon pour
maximiser l'accélération de l'hybridation. Par exemple, la
chambre peut être configurée de manière à ce que la totalité
15 de l'échantillon soit soumise au champ de I'électrophorèse ;
ceci peut être fait de nombreuses manières différentes ; par
exemple, en utilisant différentes geometries (triangulaire,
etc.), en faisant en sorte que l'électrode recouvre une ou
plusieurs surfaces internes de la chambre, etc.
20
Dans un mode de réalisation préféré, la concentration de
l'analyte cible est accomplie en utilisant au moins un agent
d'exclusion de volume dans le mélange de réactif de dosage.
Dans ce mode de réalisation, l'inclusion d'un agent
25 d'exclusion de volume, qui peut absorber du solvant et de
petites molécules comme des ions, mais qui exclut de plus
grosses molécules comme les analytes cibles, concentre
l'analyte cible à des volumes apparents plus petits, et réduit
ainsi le volume diffusionnel effectif que l'analyte cible
30 connaît, augmentant ainsi la probabilité que la cible trouve
un ligand de capture. Comme l'appréciera l'homme du métier,
des agents d'exclusion de volume peuvent ne pas nécessairement
concentrer l'échantillon près de l'électrode de détection ; il
réduit plutôt le volume diffusionnel effectif que l'analyte
35 cible connaît ou à la taille duquel il se met.46
Ainsi, les procédés de l'invention incluent l'ajout d'au moins
un agent d'exclusion de volume au mélange de la gamme. Comme
l'appréciera l'homme du métier, ceci peut être fait à presque
n'importe quelle étape du dosage, y compris le prémélange de
5 l'agent d'exclusion 'avec l'échantillon, préalable à l'ajout de
réactifs additionnels (comme des sondes de traçage, etc.),
l'ajout de l'agent d'exclusion avec un ou plusieurs autres
réactifs de dosage, ou après l'ajout des réactifs de dosage.
Alternativement, la chambre de détection peut être
10 prérecouverte par un agent d'exclusion de volume (par exemple
agarose, sephadex, sepharose, Polyacrylamide, etc.) qui va
gonfler en présence de l'échantillon. Dans certains modes de
réalisation, une membrane imperméable à l'analyte cible peut
être utilisée pour séparer l'agent d'exclusion de l'électrode
15 de détection. De manière similaire, d'autres composants du
système peuvent être recouverts par des agents d'exclusion de
volume gonflables, comme les particules magnétiques décrites
ici. En général, l'ajout de l'agent avec les autres réactifs
de dosage est préférable. Une fois ajouté, il exige
20 généralement une étape d'incubation comme l'appréciera l'homme
du métier.
Les agents d'exclusion de volume convenables sont connus dans
la technique, et incluent, mais sans s'y limiter, du dextran,
25 du sulfate de dextran, du sulfate de chonchritin, du
polyéthylèneglycol, du polysulfonate, du sulfate d'héparine,
de l'hespan, de l'acide nucléique à poids moléculaire élevé,
etc. Voir par exemple Amasino, Anal. Chem, 152:304 (1986) ;
Wetmur, Biopolymers 14:2517 (1975) ; Renz et al., Nucl. Acid
30 Res. 12:3435 (1984) ; Wahl et al., PNAS USA 75:3683 (1979) ;
et Gingeras et al., Nucl. Acid Res. 15:5373 (1987). En outre,
comme l'appréciera l'homme du métier, des mélanges de ces
agents peuvent aussi être effectués. Il doit être noté que
l'exclusion de volume est une étape de concentration, mais que
35 l'agent d'exclusion peut être considéré comme un accélérateur
d'hybridation, comme expliqué brièvement ci-dessous.47
Dans un mode de réalisation préféré, la concentration de
l'analyte cible est faite en précipitant 1'analyte cible.
C'est particulièrement efficace pour les acides nucléiques.
Comme on a montré précédemment, la précipitation des acides
5 nucléiques peut augmenter le taux d'hybridation par 50 à 100 ;
voir EP 0 229 442 Al. Comme ci-des sus, la précipitation est
une étape de concentration, mais l'agent de précipitation peut
être considéré comme un accélérateur d'hybridation, comme
expliqué brièvement ci-dessous. Dans un mode de réalisation
10 préféré, les conditions qui précipitent l'acide nucléique
double brin mais pas l'acide nucléique simple brin sont
sélectionnées, cela fournit une forte force moteur et réduit
les pertes non spécifiques.
15 Les agents de précipitation de l'acide nucléique convenables
comprennent, mais sans s ' y limiter, les sels qui contiennent
au moins un des plus forts groupes d'anions ou de cations (y
compris les sels de métal alcalin et les sels d'ammonium de
S04, P04, Ligand et COOH) ; les composés organiques qui sont
20 miscibles avec la solution de recrutement et qui ont des
propriétés de précipitation ou de salage, y compris mais sans
s'y limiter, un détergent (voir Pontius et al. , PNAS USA
88:8237 (1991), du dihydroxybenzène, du sarkosyl(sel de sodium
N-laurosarconsine), du dodécylsulfate de sodium, du
25 sulfosuccinate de diisobutyle de sodium et du sulfate de
tétradécyle de sodium. Les concentrations convenables de
chaque agent sont décrites dans les références incorporées. Il
doit être noté que dans certaines applications comme expliqué
brièvement ci-dessous, les détergents n'ont pas réellement
30 besoin de précipiter l'acide nucléique mais ils sont plutôt
ajoutés en tant qu'accélérateurs d'hybridation.
En outre, comme décrit dans EP 0 22 9 442 Al, des réactifs
additionnels peuvent être ajoutés, y compris, mais sans s'y
35 limiter, EGTA, EDTA, SDS, SK, PK, EtOH, urée, guanidine HCl,
glycogène et amphyle dilué.48
De plus, des concentrations connues d'au moins un agent
dénaturant 1'acide nucléique comme 1'alcool peuvent être
ajoutées.
5 Comme ci-dessus, ï'addition d'agents de précipitation de
l'acide nucléique peut être effectuée à pratiquement n'importe
quelle étape du dosage, comprenant le prémélange de l'agent
avec l'échantillon, avant l'ajout de réactifs additionnels
(comme des' sondes de traçage, etc.), l'ajout de l'agent avec
10 un ou plusieurs autres réactifs de dosage, ou après l'ajout
des réactifs de dosage. En général, l'ajout de l'agent avec
les réactifs de dosage est préférable. En outre, une fois
qu'il est ajouté, il existe généralement une étape
d'incubation comme l'appréciera l'homme du métier.
15
Dans un mode de réalisation préféré, la concentration est
effectuée en ajoutant au moins deux réactifs qui forment deux
phases de solution séparables, de manière à ce que l'analyte
cible concentre dans une des phases ou au niveau de
20 l'interface. Comme il est connu dans le métier, si un
échantillon est soumis à deux phases de solution séparables,
une analyte cible peut être conduite d'une phase à une autre
et donc peut devenir concentrée dans une phase, ou dans
certains circonstances la concentration peut avoir lieu à
25 l'interface entre les deux phases. Voir par exemple Albertsson
et al. Biochimica et Biophysica Acta 103:1-12 (1965), Kohne et
al., Biochem 16 (24): 5329 (1977), Müller, Partitioning of
Nucleic Acids, Ch.7 in Partitioning in Aqueous Two-Phase
Systems. Academic Press, 1985), et Müller et al., Anal.
30 Biochem. 118:269 (1981) . Ainsi, en configurant le volume de
l'échantillon, le volume de chaque phase, la chambre
d'électrode de détection et la position de l'électrode de
détection, on peut atteindre une bonne concentration à
1'électrode. Comme le montre Müller, Partitioning of Nucleic
35 Acids, Ch.7 in Partitioning in Aqueous Two-Phase Systems.
Academic Press, 1985) et Albertsson, supra, la séparation est
effectuée par composition d'électrolyte, y compris à la fois49
la force ionique et le type des ions, la concentration de
polymères, la taille des acides nucléiques, la structure et/ou
la complexité des acides nucléiques, et la présence ou
l'absence de certains ligands.
5
Dans un mode de réalisation préféré, les ligands peuvent être
compris dans les mélanges de séparation pour effectuer la
séparation. Comme montré à la fois dans les références Müller
et al., '1'inclusion de ligands qui fixent les acides
10 nucléiques peut effectuer la séparation. Ainsi, par exemple,
l'utilisation de colorants de fixation des acides nucléiques
liée de manière covalente à des chaînes hétéroalkyle comme le
PEG peut fortement augmenter les coefficients de séparation.
Voir Müller et al. , Anal. Biochem. 118:269 (1981), Müller et
15 al.. Anal. Biochem 118:267 (1981) ; et Müller et al., Eur. J.
Biochem 128:231 (1982).
Dans un mode de réalisation préféré, on effectue la technique
de réassociation par emulsion de phénol (PERT) comme décrit
20 dans Kohne et al., supra. Dans ce mode de réalisation, du
phénol et de l'eau (ou d'autres solutions aqueuses) sont
ajoutés dans les bonnes proportions et mélangés ou mixés. Une
emulsion se forme. Quand on arrête de mélanger, l'émulsion
s'arrête, et deux phases se forment. L'ajout d'acide nucléique
25 à simple brin et de sel à la phase aqueuse résulte en une
formation d'hybride extrêmement rapide. Comme expliqué
brièvement' dans Kohne, supra, le taux d'hybridation de l'acide
nucléique dépend de (a) la présence de 1 'emulsion ; (b) le
type et la concentration des ions ; (c) une température
30 appropriée d'incubation ; (d) le pH qui convient ; (e) le taux
et la manière d'agitation de 1'emulsion ; (f) la quantité de
phénol présent ; (e) la taille du fragment de 1'acide
nucléique (h) la complexité de l'acide nucléique ; et (i) la
concentration de l'acide nucléique.
35
En outre/ la séparation est aussi connue pour les protéines ;
(voir Gineitis et al., Anal. Biochem. 139:400 (1984).50
Dans un mode de réalisation préféré, l'exclusion de volume et
la séparation peuvent être faits simultanément. Par exemple,
du dextran (3-8 %) et du PEG (3,5 à 6 %) peuvent être mélangés
5 et former des phases' séparées. Des déplacements dans les taux
de cations^ ou d'anions peuvent transférer des acides
nucléiques à poids moléculaire élevé d'une phase à une autre
et provoquer la formation de duplex.
10 Dans un mode de réalisation préféré, l'étape de concentration
est effectuée en utilisant des particules navettes. En
général, cette technique peut être décrite comme suit. On
utilise les particules navettes qui vont soit se fixer par
gravité sur l'électrode de détection (par exemple quand
15 l'électrode de détection et au "fond") soit flotter (par
exemple quand l'électrode de détection et en "haut" de la
chambre) ou peuvent être poussées à s'associer à l'électrode
de détection (par exemple par l'utilisation de particules
magnétiques). Ces particules navettes comprend des ligands de
20 fixation qui vont s'associer avec la ou les analytes cibles
dans la solution de dosage, généralement mais pas toujours de
manière non spécifique, et ensuite conduire les analytes
cibles à l'électrode de détection, ou elles peuvent être
relâchées pour se fixer au ligand de fixation de capture. Soit
25 directement soit indirectement, comme expliqué brièvement ci-
dessous) . Comme l'appréciera l'homme du métier, les ligands de
fixation navette interagissent préférablement moins fortement
avec les analytes cibles que les composants du complexe de
dosage, c'est-à-dire le ligand de fixation de capture. C'est-
30 à-dire que l'interconnexion avec la particule navette doit
être suffisamment faible pour permettre la libération des
analytes cibles pour la fixation à l'électrode de détection.
Dans un mode de réalisation préféré, l'analyte cible est un
35 acide nucléique et les particules navettes peuvent être
configurées en certains nombres de moyens. Dans un système,
les particules navettes comprennent généralement des petites51
sondes d'acide nucléique (c'est-à-dire 4 à 10, bien que
suivant la température utilisée, elle puisse être plus longue)
qui peuvent se fixer à des analytes cibles. Celles-ci peuvent
être soit spécifiques, c'est-à-dire qu'elles contiennent des
5 séquences courtes 'spécifiques à ou aux analytes cibles
d'intérêt, ou non spécifiques, c'est-à-dire des sondes au
hasard qui vont conduire la totalité de l'acide nucléique dans
1'échantillon à la surface. La liaison des acides nucléiques
aux particules est connue ; voir par exemple U.S.S.N.
10 60/105875 et les matériaux par Chad Mirkin. De manière
similaire, pour les cibles d'acide nucléique, les ligands
ayant des affinités de fixation qui varient peuvent être
utilisés ; par exemple, un anticorps se fixant faiblement à
une cible de protéine peut être lié à la bille, et un
15 anticorps de plus forte affinité peut servir de ligand de
capture sur la surface. En variante, des changements de
solution peuvent être utilisés pour guider le transfert de la
bille vers la surface.
20 En variante, à la fois pour les acides nucléiques et pour
d'autres types d'analytes y compris les protéines, les
particules peuvent être modifiées (par exemple par dérivation
avec des groupes caractéristiques d'aminé (comme des groupes
caractéristiques de lysine) ou des groupes carboxy) pour
25 contenir une charge pour l'interaction électrostatique de la
cible et de la particule.
Dans un mode de réalisation préféré, à nouveau quand les
analytes cibles sont des acides nucléiques, les particules
30 navettes peuvent contenir des composants de fixation d'acide
nucléique, qui se fixent à des acides nucléiques simple brin
ou à des acides nucléiques double brin. Par exemple, des
particules comprenant des intercalaires sont connues : voir le
brevet des Etats-Unis 5 582 984 incorporé ici à titre de
35 référence dans son intégralité. De manière similaire, des
particules comprenant des protéines de fixation simple brin ou
double brin peuvent être effectuées. Une fois à la surface de52
détection, les analytes cibles peuvent être libérées en
utilisant des techniques connues, comprenant la chaleur, les
changements de pH, les changements de sel, etc. Il doit être
noté que ces particules peuvent avoir une utilité dans la
5 préparation de l'échantillon, comme les particules peuvent se
lier à toute analyte cible, permettant à l'échantillon restant
d'être nettoyé ou enlevé, ou aux particules comprenant
l'analyte cible d'être enlevées de l'échantillon.
10 Dans un mode de réalisation préféré, la surface de
l'électrode, ou du substrat comme décrit ici, peut être
altérée pour augmenter la fixation et/ou pour réduire l'espace
diffusionnel effectif pour l'analyte cible. C'est-à-dire que
la réduction de l'espace diffusionnel de trois dimensions (la
15 chambre de détection) à deux dimensions (la surface de
détection) va augmenter nettement la cinétique de fixation.
Cette réduction peut être accomplie de plusieurs manières. Par
exemple, dans un mode de réalisation préféré, les groupes
terminaux de SAM peuvent être modifiés pour comprendre des
20 programmes électrostatiques de charges opposées en provenance
de l'analyte cible. Ainsi, le temps pendant lequel une
molécule cible particulière s'associe à la surface est
augmenté, et la diffusion a lieu préférablement en deux
dimensions plutôt qu'en trois. Ceci enlève efficacement les
25 analytes cibles de la couche de diffusion au-dessus de la
surface de détection, formant ainsi une pente qui entraîne les
nouvelles analytes cibles vers le bas dans la couche de
diffusion. Ainsi, par exemple, des agents de passivation
terminés par des cations peuvent être utilisés, comme HS-CH2-
30 NR3+. En variante, le substrat entier de la chambre de
détection (c'est-à-dire les zones autour des électrodes
individuelles) peut être recouvert avec des ligands de
fixation faibles, similaires aux particules navettes décrites
ici, formant "pelouse" de ligand de fixation. Par exemple, les
35 sondes d'oligonucléotides, qui vont soit se fixer
spécifiquement à des séquences cibles ou qui sont des
séquences relativement courtes non spécifiques, peuvent être53
utilisées sur la surface. Sur l'association d'une séquence
cible avec ces sondes de surface, la diffusion par
1'intermédiaire d'une fixation d'équilibre et la libération va
permettre une diffusion bidimensionnelle plutôt qu'une
5 diffusion tridimensionnelle. Dans ce mode de réalisation, ce
qui est important est que 1'interaction entre les ligands de
surface et les analytes cibles soit plus faible que celle des
ligands de capteur, de manière à ce que la fixation aux
ligands de' capture soit préférée. Ceci peut être contrôlé dans
10 le cas des acides nucléiques utilisant une longueur de sonde ;
les sondes de capture vont généralement être plus longues que
les sondes de surface. Comme l'appréciera l'homme du métier,
ces techniques peuvent être effectuées seules ou en plus de
n'importe laquelle des autres techniques d'accélération
15 expliquées brièvement ici.
En outre, comme il est décrit de manière plus précise ci-
dessous, les particules peuvent aussi être utilisées comme
"particules de mélange", qui servent à remuer la solution près
20 de l'électrode de détection et ainsi augmenter l'hybridation.
Dans un mode de réalisation préféré, l'accélération de
fixation est effectuée en configurant le système pour
maximiser la quantité d'analyte cible qui peut se fixer à
25 l'électrode de détection dans une période de temps donné. Ceci
peut être fait par exemple en faisant circuler devant ou en
exposant un large volume d'échantillon contenant l'analyte
cible à l'électrode de détection de manière à ce que les
analytes cibles aient une forte probabilité de s'associer avec
30 l'électrode de détection.
En conséquence, dans un mode de réalisation préféré, les
procédés comprennent la circulation de 1'échantillon contenant
l'analyte ou les analytes cibles devant une électrode de
35 détection pour former les complexes de dosage. Dans ce mode de
réalisation, la concentration de 1'analyte cible a lieu comme
étant le résultat du contact entre un gros volume54
d'échantillon et l'électrode de détection par unité de temps,
et réduit aussi les périodes de fixation en comparaison à un
échantillon stagnant. Ainsi, dans un mode de réalisation
préféré, comme expliqué brièvement ci-dessus pour
5 I'électrophorèse, le système comprenant l'électrode de
détection peut être configuré pour faire passer l'échantillon
devant ou à travers l'électrode de détection. Ainsi, un mode
de réalisation préféré utilise une électrode poreuse comme une
électrode ' en or, comme expliqué brièvement ci-dessus,
10 positionnée dans un canal de circulation d'échantillon. Voir
par exemple le document W095/11755,' incorporé à titre de
référence. L'échantillon peut être mis à recirculer
additionnellement si nécessaire. Les électrodes à disque
tournant sont aussi préférées.
15
Ainsi, dans un mode de réalisation préféré, l'électrode de
détection et la zone qui l'entoure est configurée pour donner
en conséquence le mélange de l'échantillon, qui peut servir à
perturber cette couche de diffusion et permettre un meilleur
20 accès à la surface. Par exemple, dans un mode de réalisation,
l'électrode de détection est placée dans un canal
d'échantillon étroit. Ainsi, essentiellement, l'électrode de
détection est une bande ou une zone autour du périmètre du
canal. En outre, comme expliqué brièvement ci-dessus, une
25 recirculation peut aussi avoir lieu.
Dans un mode de réalisation, en variante, l'électrode de
détection est configurée par rapport à la chambre de manière à
ce que la circulation de l'échantillon devant l'électrode
30 cause le mélange ou une turbulence de l'échantillon. Par
exemple, dans un mode de réalisation, l'électrode de détection
est "immergée" ou "encastrée" par rapport à la chambre, de
manière à ce que la circulation de l'échantillon devant
l'électrode cause un mélange ; voir figure 13. Cet essai peut
35 être amélioré en incluant des surfaces dressées, auxquelles on
fait parfois référence ici sous le terme de "barrages" sur les55
côtés de 1 ' électrode (y compris des électrodes immergées) qui
causent un mélange.
En plus de n'importe, lequel des procédés décrits ici ou à la
5 place de ceux-ci, un mode de réalisation préféré utilise des
particules comme "des balles de mélange". Par "particule" ou
"microparticule" ou "nanoparticule" ou "bille" ou
"microsphère" on entend ici une matière microparticulaire.
Comme l'appréciera l'homme du métier, les particules peuvent
10 comprendre une grande variété de matériaux selon leur
utilisation, y compris, mais sans s'y limiter, de l'amidon à
liaison croisée, des dextrans, de la cellulose, des protéines,
des polymères organiques incluant des polymères de styrène
incluant du polystyrène et du méthylstyrène tout comme
15 d'autres copolymères de styrène, plastique, verre, céramique,
polymères acryliques, matériaux réceptifs magnétiquement
parlant, colloïdes, thoria sol, carbone graphite, dioxyde de
titane, nylon, latex, et téflon peuvent tous être utilisés.
"Microsphere Détection Guide" de Bangs Laboratories, Fishers
20 IN. est un guide utile. Les modes de réalisation préférés
utilisent des particules magnétiques comme expliqué brièvement
ci-dessous. En outre, dans certains exemples, la particule de
mélange n'a pas besoin de comprendre de matière
microparticulaire ; par exemple, pour le mélange de gravité
25 (c'est-à-dire pour le mélange basé sur l'agitation du
système), tout composant ayant une densité différente de
l'échantillon peut être utilisé ; les bulles d'air peuvent
être utilisées par exemple comme des particules de mélange.
30 Dans d'autres modes de réalisation, les particules de mélange
peuvent être choisies parce qu'elles ont une forte constante
diélectrique de manière à ce que les particules puissent être
déplacées par l'application vers un gradient de champ
électromagnétique comme on pourrait en produire en utilisant
35 une lumière focalisée ou un champ de fréquences radio-
divergent (rf). Les particules pourraient aussi, dans certains
exemples, comprendre des matériaux diamagnétiques. De telles56
particules ne seraient pas sensiblement affectées par
l'application d'un champ magnétique linéaire mais pourraient
être déplacées par l'application d'un champ magnétique non
linéaire comme on pourrait en appliquer en utilisant un aimant
5 non linéaire ou en utilisant un gros aimant linéaire combiné à
de petites inclusions ferro-magnétiques ou para-magnétiques
dans la chambre.
La taille ' des particules va dépendre de leurs compositions.
10 les particules n'ont pas besoin d'être sphériques. Des
particules irrégulières peuvent être utilisées. En outre, les
particules peuvent être poreuses, augmentant ainsi la zone de
surface de la particule disponible de groupes
caractéristiques. En général, la taille des particules va
15 varier avec leurs compositions ; par exemple les particules
magnétiques sont généralement plus grosses que les particules
colloïdales. Ainsi, les particules ont des diamètres allant de
1 à 5 mm (colloïdes) à 200 pm (particules magnétiques).
20 Comme l'appréciera l'homme du métier, les particules peuvent
être ajoutées à n'importe quel point au cours du dosage, y
compris avant, pendant ou après l'ajout de l'échantillon.
Des particules aident à remuer 1'échantillon pour effectuer
25 plus de fixation de la cible. Ceci peut être accompli d'un
certain nombre de manières. Par exemple, des particules
peuvent être ajoutées à la chambre de détection et la chambre
en entier ou le système agité. Dans un mode de réalisation,
les microparticules magnétiques comme celles connues dans le
30 métier peuvent être utilisées. Dans un mode de réalisation
préféré, la première particule est une particule magnétique ou
une particule qui peut être amenée à montrer des propriétés
magnétiques. Par "magnétique" on entend ici que la particule
est attirée dans un champ magnétique, y compris ferro-
35 magnétique, para-magnétique, et diamagnétique. Dans ce mode de
réalisation, les particules ont de préférence un diamètre
allant d'environ 0,001 à environnement 200 pm, les diamètres57
allant d'environ 0,05 à environ 200 pm étant préférés,
d'environ 0,1 à environ 100 pm étant particulièrement
préférés, et d'environ 0,5 à environ 10 pm étant spécialement
préférés.
5
Dans ce mode de réalisation, il peut être préféré de varier la
direction et/ou la force du champ magnétique, par exemple en
utilisant des électroaimants positionnés autour de la chambre
de détection pour déplacer les billes dans une variété de
10 directions. Ainsi, par exemple, l'utilisation de particules
navettes magnétiques, aussi bien les particules de mélange que
les particules navettes, peut être accomplie par des champs
magnétiques multiples ; l'un qui entraîne les particules vers
le bas, vers l'électrode de détection, et l'autre qui agite
15 les billes sur la surface de l'électrode de détection. En
variante, les particules non magnétiques peuvent être ajoutées
pour augmenter le mélange type circulant expliqué brièvement
ci-dessus.
20 La taille des microparticules va varier comme expliqué
brièvement ici. On a observé que des microparticules de 4,5 pm
restent en solution sur un support solide, relativement non
affectées par la diffusion, alors que dans le même échantillon
1,0 pm de particules restent suspendues loin de la surface
25 solide et il apparaît qu'elles suivent les contraintes de la
diffusion. Ainsi, les particules les plus grosses peuvent se
déplacer librement à l'intérieur de la couche de diffusion
lorsqu'elles sont combinées avec le flux, pour transformer le
flux laminaire en flux turbulent.
30
En outre, les particules peuvent être chimiquement altérées,
par exemple avec des agents d'exclusion de volume ou des
accélérateurs d'hybridation comme expliqué brièvement ici pour
combiner les effets d'accélération.
3558
Comme l'appréciera l'homme du métier, les particules navettes
expliquées brièvement ci-dessus peuvent aussi avoir une double
fonction de particules de mélange.
5 Ainsi la présenté invention fournit des compositions
comprenant des électrodes de détection et des particules de
mélange, et des procédés pour détecter les analytes cibles en
utilisant les compositions.
10 En outre, comme il est connu dans le métier, on pense que
l'une des étapes de limitation du taux de capture de cible sur
une surface est la diffusion de molécules à travers la couche
limite près de la phase solide. Il n'apparaît pas que cette
couche limite se mélange bien même pendant la circulation de
15 1'échantillon. Cette couche limite et sa profondeur
statistique est une fonction des propriétés du solvant, du
solide et du soluté. Ainsi, une altération de ces paramètres
peut servir à "faire rétrécir" la couche limite que l'analyte
cible doit passer pour atteindre la surface. Par exemple,
20 l'ajustement du contenu organique du soluté peut rendre
l'analyte plus accessible à la surface. D'autres paramètres
peuvent effectuer ceci comme la viscosité, la charge de la
surface, la structure seconde et tertiaire de la cible, et la
température.
25
Dans un mode de réalisation préféré, quand l'analyte cible est
un acide nucléique, l'accélération de fixation est effectuée
en utilisant un accélérateur d'hybridation. Dans ce mode de
réalisation, la fixation de l'analyte cible à l'électrode de
30 détection est effectuée en présence d'un accélérateur
d'hybridation. Comme expliqué brièvement ici, il existe une
variété d'accélérateurs d'hybridation qui augmentent en fait
le taux d'hybridation d'acide nucléique, y compris mais sans
s'y limiter, les protéines de fixation d'acide nucléique, les
35 sels, les ions polyvalents et les détergents.59
Dans un mode de réalisation préféré, 1'accélérateur
d'hybridation est une protéine de fixation d'acide nucléique.
Comme il a été montré dans le métier, certaines protéines de
fixation augmentent. le taux d'hybridation des acides
5 nucléiques simple brin ; voir Pontius et al., PNAS USA 87:8403
(1990) et le brevet des Etats-Unis 5 015 569. Ainsi, par
exemple, hnRNP (Al hnRNP) et recA sont tous connus pour
augmenter le taux d'annelage des acides nucléiques double
brin. D'autres protéines de fixation d'acide nucléique simple
10 brin et des protéines majeures et mineures de fixation de
sillons peuvent aussi être utilisées. Les conditions
convenables sont connues ou élucidées par l'art antérieur.
Dans un mode de réalisation préféré, l'accélérateur
15 d'hybridation est un sel. Comme il est connu dans le métier,
1'inclusion de fortes concentrations de sel peut augmenter le
taux d'hybridation ; voir EP 0 229 442 Al. Généralement, les
concentrations de sel jusqu'à environ 2 M peuvent augmenter le
taux d'hybridation. Des sels convenables comprennent, mais
20 sans s'y limiter, le chlorure de sodium, le chlorure de
césium, le phosphate de sodium, le Perchlorate de sodium, le
chlorure de lithium, le chlorure de potassium, le bromure de
sodium, le sulfate de sodium et le chlorure d'ammonium.
25 Dans un mode de réalisation préféré, l'accélérateur
d'hybridation est un ion polyvalent. Les ions de valence
supérieurs comme Mg++ peuvent améliorer l'affinité des brins
d'acide nucléique par l'intermédiaire des interactions
électrostatiques et accélérer ainsi 1'hybridation. En outre,
30 ces ions polyvalents peuvent potentiellement affecter
1'encapsidation à la surface ; c'est-à-dire que comme la
densité d'acide nucléique à la surface augmente, une charge
négative s'accumule qui peut inhiber la fixation ultérieure de
plus d'acide nucléique. Ainsi, l'inclusion d'un ion polyvalent
35 qui peut servir de "pont salin" peut servir pour augmenter
l'hybridation. Mn++ peut avoir un effet similaire.60
En outre, on a montré que certains ions comme Mg++ peuvent
améliorer la fixation dans 1'ARN par d'autres procédés. L'ARN
forme des boucles autour des ions Mg++ et trouve une structure
secondaire stable se coordonnant avec Mg++. Si Mg++ est
5 enlevé, 1'ARN changé vers une autre structure qui est aussi
stable. Cependant, la phase de transition peut être une
période d'accessibilité améliorée pour les sondes arrivantes.
Ainsi, l'ajout de tours séquentiels de Mg++ suivi par EDTA ou
un chélateur similaire peut créer un cycle au travers de cette
10 phase de transition et améliorer la fixation.
Dans un mode de réalisation préféré, l'accélérateur
d'hybridation est un détergent ; voir Pontius et al., PNAS USA
88:8237 (1991). Dans ce cas, certains détergents peuvent
15 augmenter le taux d'hybridation par au moins 10'1. Des
détergents convenables comprennent mais sans s ' y limiter, des
détergents cationiques y compris, mais sans s'y limiter, du
bromure de dodécyltriméthylammonium (DTAB) et du bromure de
cétyltriméthylammonium (CTAB), et d'autres variantes de
20 l'aminé quaternaire bromure de tétraméthylammonium (TMAB).
Tous les procédés ci-dessus sont dirigés en vue d'augmenter la
quantité d'analytes cibles accessibles pour la fixation et la
détection sur l'électrode de détection dans une période de
25 temps donné. Les systèmes de détection de la présente
invention sont basés sur 1'incorporation d'une moitié de
transfert d'électron (ETM) dans un complexe de dosage comme le
résultat de la fixation de l'analyte cible.
30 En général, il existe deux mécanismes de détection basiques.
Dans un mode de réalisation préféré, la détection d'une ETM
est basée sur le transfert d'électrons au travers des
orbitales-rc superposables d'acide nucléique double brin. Ce
mécanisme basique est décrit dans les brevets des Etats-Unis
35 N° 5 591 578, 5 770 369, 5 705 348 et PCT US97/20014 et il est
appelé ici "mécanisme-1". En bref, le travail préalable a
montré que le transfert d'électrons passait rapidement à61
travers les orbitales-)! superposables de l'acide nucléique
double brin, et significativement plus lentement au travers de
l'acide nucléique simple brin. En conséquence, ceci peut
servir comme base d'un dosage. Ainsi, en ajoutant des ETM
5 (soit de manière covalente à l'un des brins soit de manière
non covalente au complexe d'hybridation au travers de
l'utilisation d'indicateurs d'hybridation, décrits ci-dessous)
à un acide nucléique qui est attaché à une électrode de
détection 'par l'intermédiaire d'un oligomère conducteur, le
10 transfert d'électrons entre l'ETM et l'électrode, au travers
de l'acide nucléique et de l'oligomère conducteur, peut être
détecté. Cette idée générale est représentée sur la figure 3.
Ceci peut être fait là ou l'analyte cible est un acide
15 nucléique ; en variante, une analyte cible d'acide non
nucléique est utilisé, avec un ligand de fixation de capture
optionnel (pour lier l'analyte cible à l'électrode de
détection) et un ligand de fixation soluble qui transporte
"une queue" d'acide nucléique, qui peut alors se fixer soit
20 directement soit indirectement à une sonde de détection sur la
surface pour effectuer la détection. Cette idée générale est
représentée sur la figure 3C.
En variante, l'ETM peut être détectée, pas nécessairement par
25 l'intermédiaire d'un transfert d'électrons au travers de
l'acide nucléique, mais plutôt peut être directement détectée
en utilisant des oligomères conducteurs ; c'est-à-dire que les
électrons des ETM n'ont pas besoin de se déplacer au travers
des orbitales n superposables afin de générer un signal. A la
30 place, la présence d'ETM sur la surface d'un SAM, qui comprend
des oligomères conducteurs, peut être directement détectée.
Cette idée basique est nommée ici "mécanisme-2". Ainsi, sur la
fixation d'une analyte cible, un ligand de fixation soluble
contenant une ETM est amené à la surface, et la détection de
35 1'ETM peut avoir lieu. Le rôle du SAM comprenant les
oligomères conducteurs est d'abriter l'électrode des
composants de la solution et réduire la quantité de fixation62
non spécifique aux électrodes. Vu sous un autre angle, le rôle
du ligand de fixation est de fournir une spécificité pour un
recrutement des ETM à la surface, où ils peuvent être détectés
en utilisant des oligomères conducteurs ayant des termini
5 exposés électroniquement. Cette idée générale est montrée sur
les figures 4, 5 et 6.
Ainsi, dans chaque mode de réalisation, comme il est expliqué
de manière* plus précise ci-dessous, un complexe de dosage est
10 formé qui contient une ETM, qui est alors détectée en
utilisant l'électrode de détection.
Le présent système trouve une utilité particulière dans les
formats de gamme, c'est-à-dire là où il y a une matrice
15 d'électrodes de détection adressables (auxquels on fait
généralement référence ici sous1 le terme de "blocs",
"adresses" ou "micro-localisations"). Par "gamme" on entend
ici une pluralité de ligands de capture dans un format de
gamme ; la taille de la gamme va dépendre de la composition et
20 de l'utilité finale de la gamme. Les gammes contenant environ
deux ligands de capture différents à plusieurs milliers
peuvent être effectuées. En général, la gamme peut aller de
deux à 100 000 ou plus, selon la taille des électrodes et
l'utilisation finale de la gamme. Les gammes préférées vont
25 d'environ 2 à environ 10 000, d'environ 5 à environ 1000
étant préféré, et d'environ 10 à environ 100 étant
particulièrement préféré. Dans certains modes de réalisation,
les compositions de l'invention peuvent ne pas être dans un
format de gamme; c'est-à-dire que, dans certains modes de
30 réalisation, les compositions comprenant un seul ligand de
capture peuvent aussi être faites. De plus, dans certaines
gammes, de multiples substrats peuvent être utilisés, de
compositions identiques ou différentes. En outre, dans
certaines gammes, des substrats multiples peuvent être
35 utilisés, de compositions identiques ou différentes. Ainsi par
exemple, de larges gammes peuvent comprendre une pluralité de
plus petits substrats.63
L'électrode de détection comprend une couche monomoléculaire
auto assemblée (S7AM) . Par "couche monomoléculaire" ou "couche
monomoléculaire auto-assemblée" ou "SAM" on entend ici un
5 groupe de molécules relativement ordonné spontanément
chimisorbé sur une surface, dans lequel les molécules ont une
orientation préférée les unes par rapport aux autres (par
exemple elles sont orientées de manière approximativement
parallèle 'les unes par rapport aux autres) et une orientation
10 préférée par rapport à la surface (par exemple à peu près
perpendiculaire à celle-ci) . Chacune des molécules inclut un
groupe fonctionnel qui adhère à la surface, et une partie qui
interagit avec les molécules avoisinantes dans la couche
monomoléculaire pour former la gamme relativement ordonnée.
15 Une couche monomoléculaire "mélangée" comprend une couche
monomoléculaire hétérogène, c'est-à-dire qu'au moins deux
molécules différentes composent la couche monomoléculaire. La
somme peut comprendre des oligomères conducteurs seuls, ou un
mélange d'oligomères conducteurs et d'isolateurs. Comme
20 expliqué brièvement ici, 1'efficacité de la fixation de
1'analyte cible (par exemple, 1'hybridation
d'oligonucléotides) peut augmenter quand l'analyte est à une
certaine distance de l'électrode. De manière similaire, une
fixation non spécifique de biomolécules, y compris les
25 analytes cibles, à une électrode est généralement réduite
quand une couche monomoléculaire est présente. Ainsi, une
couche monomoléculaire facilite le maintien de l'analyte loin
de la surface de l'électrode. En outre, une couche
monomoléculaire permet de garder les espèces électroactives
30 extérieures éloignées de la surface de l'électrode. Ainsi,
cette couche aide à prévenir tout contact électrique entre les
électrodes et les ETM, ou entre l'électrode et les espèces
électroactives extérieures à l'intérieur du solvant. Un tel
contact peut résulter en un "court-circuit" direct ou un
35 court-circuit indirect par l'intermédiaire des espèces
chargées- qui peuvent être présentes dans l'échantillon. En
conséquence, dans un mode de réalisation, la couche64
monomoléculaire est fermement enserrée dans une couche
uniforme sur la surface de l'électrode, de manière à ce qu'il
existe un minimum de "trous". Dans ce mode de réalisation, la
couche monomoléculaire sert alors de barrière physique pour
5 bloquer l'accessibilité du solvant à l'électrode.
Dans un mode de réalisation préféré, la couche monomoléculaire
comprend des oligomères conducteurs. Par "oligomère
conducteur" on entend ici un oligomère sensiblement
10 conducteur, de préférence linéaire, certains modes de
réalisation de celui-ci y faisant référence dans les ouvrages
sous le terme de "fils moléculaires". Par "sensiblement
conducteur" on entend ici que l'oligomère est capable de
transférer des électrons à 100 Hz. Généralement, l'oligomère
15 conducteur a essentiellement des orbitales n qui se
chevauchent, c'est-à-dire des orbitales n conjuguées, comme
entre les unités monomériques de l'oligomère conducteur, bien
que l'oligomère conducteur puisse aussi contenir une ou
plusieurs liaisons sigma (a) . En outre, un oligomère
20 conducteur peut être défini fonctionnellement par sa capacité
à injecter ou à recevoir des électrons à l'intérieur ou depuis
une ETM associée. De plus, 1'oligomère conducteur est plus
conducteur que les isolateurs comme défini ici. En outre, les
oligomères conducteurs de la présente invention doivent être
25 distingués des polygomères électroactifs, qui eux mêmes
peuvent donner ou accepter des électrons.
Dans un mode de réalisation préféré, les oligomères
conducteurs ont une conductibilité S entre environ IO"6 et
30 environ 10"3' Q^crrf1, de préférence d'environ IO"5 à environ IO"3
Q"1cm~1, des valeurs S étant calculées pour des molécules
allant d'environ 20 Â à environ 200 Â. Comme décrit ci-
dessous, des isolateurs ont une conductibilité d'environ 10~
Q_1cm_1 ou inférieure, de préférence inférieure à 10~8 O- cm" .
35 Voir généralement Gardner et al.. Sensors et Actuators A 51
(1995)57-6665
Les caractéristiques souhaitées d'un oligomère conducteur
comprennent une forte conductibilité, une solubilité
suffisante dans des solvants organiques et/ou de l'eau pour la
synthèse et l'utilisation des compositions de l'invention, et
5 de préférence une résistance chimique aux réactions qui a lieu
i) au cours de la synthèse du ligand de fixation (c'est-à-dire
la synthèse d'acide nucléique, de manière à ce que les
nucleosides contenant les oligomères conducteurs puissent être
ajoutés au synthétiseur d'acide nucléique au cours de la
10 synthèse des compositions de l'invention, ii) au cours de la
liaison de l'oligomère conducteur à un oxyde, ou iii) au cours
des essais de dosage. En outre, les oligomères conducteurs qui
vont promouvoir la formation de couches monomoléculaires auto-
assemblées sont préférés.
15
Les oligomères de la présente invention comprennent au moins
deux sous-unités monomériques, comme décrit ici. Comme décrit
plus amplement ci-dessous, les oligomères comprennent des
homo-oligomères et des hétéro-oligomères, et comprennent des
20 polymères.
Dans un mode de réalisation préféré, l'oligomère conducteur a
la structure représentée dans la structure 1 :
25 Structure 1
Comme le comprendra l'homme du métier, toutes les structures
représentées ici peuvent avoir des atomes ou des structures
additionnels ; c'est-à-dire que l'oligomère conducteur de la
30 structure 1 peut être attaché aux ETM, comme les électrodes,
les complexes de métal de transition, les ETM organiques et
les métallocènes, et à des ligands de fixation comme les
acides nucléiques, ou à 'plusieurs de ceux-ci. Sauf si cela est
écrit autrement, les oligomères conducteurs représentés ici
35 vont être liés au côté gauche d'une électrode ; c'est-à-dire,
comme représenté dans la structure 1, le "Y" de gauche est66
relié à 1'électrode comme décrit ici. Si 1'oligomère
conducteur doit être lié à un ligand de fixation, le "Y" de
droite, s ' il est présent, est lié au ligand de fixation comme
un acide nucléique, .soit directement soit par 1'utilisation
5 d'un lieur, comme décrit ici.
Dans ce mode de réalisation, Y est un groupe aromatique, n est
un nombre entier relatif de 1 à 50, g est soit 1 soit zéro, e
est un nombre entier relatif de zéro à 10, et m est soit zéro
10 soit 1. Quand g est égal à 1, B-D est une liaison capable de
se conjuguer avec les liaisons environnantes (on y fait
référence ici sous le terme liaison conjuguée A @) ) ,
sélectionnée de préférence parmi un acétylène, un alcène, un
alcène substitué, un amide, azo, -C=N- (y compris -N=C-,
15 -CR--N- et -N=CR-) , -Si=Si-, et -Si=C (y compris -C=Si-,
-Si=CR, et CR=Si-) . Quand g est égal à zéro, e est de
préférence 1, D est de préférence carbonyle ou un groupe
caractéristique d'hétéroatome, où 1'hétéroatome est
sélectionné parmi l'oxygène, le sulfure, l'azote, le silicium
20 ou le phosphore. Ainsi, les groupes caractéristiques
d'hétéroatome convenables comprennent, mais sans s'y limiter,
-NH et -NR, où R est tel que défini ici ; sulfure substitué ;
sulfoxyde (-SO2-) de sulfonyle (-SO-) ; oxyde phosphore (-PO-
et -RPO-) ; thiophosphine (-PS- et -RPS-). Cependant, quand
25 l'oligomère conducteur doit être lié à une électrode en or,
comme expliqué brièvement ci-dessous, des dérivés de sulfure
ne sont pas préférés.
Par "groupe aromatique" ou équivalents grammaticaux on entend
30 ici un groupe caractéristique d'hydrocarbone monocyclique ou
polycyclique contenant généralement 5 à 14 atomes de carbone
(bien que des structures d'anneaux polycycliques supérieurs
peuvent être créées) et tout dérivé de cétone ou thiocétone
carbocyclique de celui-ci, dans lequel l'atome de carbone avec
35 la valence libre est un membre d'un anneau aromatique. Des
groupes aromatiques comprennent des groupes arylène et des
groupes aromatiques avec plus de deux atomes enlevés. Pour les67
luttes de cette demande, aromatique comprend hétérocycle.
"Hétérocycle" ou "hétéroaryle" signifie un groupe aromatique
dans lequel 1 à 5 des atomes de carbone indiqués sont
remplacés par un hétéroatome choisi parmi l'azote, l'oxygène,
5 le sulfure, le phosphore, le bore et le silicium dans lequel
l'atome ayant la valence libre est un membre d'un anneau
aromatique, et tout dérivé de cétone ou de thiocétone
hétérocycle de celui-ci. Ainsi, un hétérocyclique comprend
thiényle, furyle, pryrrolyle, pyrimidinyle, oxalyle, indolyle,
10 purinyle, quinolyle, isoquinolyle, thiazolyle, imidozyle, etc.
Il est important de noter que les groupes aromatiques Y de
1'oligomère conducteur peuvent être différents, c'est-à-dire
que l'oligomère conducteur peut être un hétéro-oligomère.
15 C'est-à-dire qu'un oligomère conducteur peut comprendre un
oligomère d'un seul type de groupes Y, ou une multiplicité de
types de groupes Y.
Le groupe aromatique peut être substitué par un groupe de
20 substitution généralement représenté ici par R. Les groupes R
peuvent être ajoutés si nécessaire pour affecter l'emballage
des oligomères conducteurs, c'est-à-dire que des groupes R
peuvent être utilisés pour altérer l'association des
oligomères dans la couche monomoléculaire. Les groupes R
25 peuvent aussi être ajoutés pour 1) altérer la solubilité de
l'oligomère ou des compositions contenant les oligomères ; 2)
altérer la conjugaison ou le potentiel' électrochimique du
système ; et 3) altérer la charge ou les caractéristiques à la
surface de la couche monomoléculaire.
30
Dans un mode de réalisation préféré, quand l'oligomère
conducteur est meilleur que les trois sous-unités, les groupes
R sont préférés pour augmenter la solubilité quand la synthèse
de la solution est effectuée. Cependant, les groupes R, et
35 leurs positions, sont choisis pour effectuer très légèrement
1'emballage des oligomères conducteurs sur une surface,
particulièrement à l'intérieur d'une couche monomoléculaire,68
comme décrit ci-dessous. En général, seulement de petits
groupes R sont utilisés à 1'intérieur de la couche
monomoléculaire, avec des groupes R plus gros généralement au-
dessus de la surface, de la couche monomoléculaire. Ainsi par
5 exemple, la liaison de groupes méthyl à la partie de
l'oligomère conducteur à l'intérieur de la couche
monomoléculaire pour augmenter la solubilité est préférée,
avec la liaison de groupes alcoxy plus long, par exemple, C3 à
CIO, et effectuée de préférence au-dessus de surface de la
10 couche monomoléculaire. En général, pour les systèmes décrits
ici, cela signifie généralement que la liaison de groupes R
significatifs d'un point de vue stérique n'est pas effectuée
sur n'importe laquelle des deux ou trois premières sous-unités
d'oligomères, selon la longueur moyenne des molécules
15 composant la couche monomoléculaire.
Les groupes R convenables comprennent, mais sans s'y limiter,
des groupes caractéristiques hydrogène, alkyle, alcool,
aromatiques, amino, amido, nitro, éther, ester, aldéhyde,
20 sulfonyle et silicium, des halogènes, des groupes contenant du
sulfure, des groupes contenant du phosphore, et des
éthylèneglycols. Dans les structures représentées ici, R est
l'hydrogène quand la position est non substituée. Il doit être
noté que certaines positions peuvent permettre deux groupes de
25 substitution R et R', dans ce cas, les groupes R et R' peuvent
être soit les mêmes soit différents.
Par "groupe alkyle" ou équivalents grammaticaux on entend ici
un groupe alkyle à chaîne ramifiée ou à chaîne droite, les
30 groupes alkyle à chaîne droite étant préférés. Si elle est
ramifiée, elle peut être ramifiée sur une ou plusieurs
positions, et à moins que ce ne soit spécifié, à n'importe
laquelle des positions. Le groupe alkyle peut avoir d'environ
1 à environ 30 atomes de carbone (Cl -C30) , le mode de
35 réalisation préféré utilisant les groupes d'environ 1 à
environ -20 atomes de carbone (Cl -C20), d'environ Cl en
passant par environ C12 à environ C15 étant préféré, et Cl à69
C5 étant particulièrement préféré, bien que dans certains
modes de réalisation le groupe alkyle peut être beaucoup plus
gros. Sont aussi compris dans la définition d'un groupe alkyle
les groupes cycloalkyle comme les anneaux C5 et C6, et les
5 anneaux hétérocycliques avec azote, oxygène, sulfure ou
phosphore. Alkyle comprend aussi hétéroalkyle, les
hétéroatomes de sulfure, l'oxygène, l'azote, et le silicone
étant préférés. Alkyle comprend les groupes d'alkyle
substitué.' Par "groupe alkyle substitué" on entend ici un
10 groupe alkyle comprenant en plus un ou "plusieurs groupes
caractéristiques de substitution "R", comme décrit ci-dessus.
Par "groupe amino" ou équivalents grammaticaux on entend ici
les groupes -NH2,~NHR et -NR2, R étant tel que défini ici.
15
Par "groupe nitro" on entend ici un groupe NO2 -
Par "groupes caractéristiques contenant du sulfure" on entend
ici des composés contenant des atomes de sulfure, y compris
20 mais sans s'y limiter, des composés thia-, thio et sulfo, des
thiols (-SH et -SR) et des sulfides (-RSR-) . Par "groupes
caractéristiques contenant du phosphore" on entend ici des
composés contenant du phosphore, y compris, mais sans s'y
limiter, des phosphines et des phosphates. Par "groupes
25 caractéristiques contenant du silicium" on entend ici des
composés contenant du silicium.
Par "éther" on entend ici un groupe -O-R. Les éthers préférés
comprennent des groupes alcoxy, -O- (CH2) 2CH3 et -O- (CH2) 4CH3
30 étant préférés.
Par "ester" on entend ici un groupe -COOR.
Par "halogène" on entend ici du brome, de l'iode, du chlore ou
35 du fluoré. Des alkyles substitués préférés sont les alkyles
partiellement ou complètement halogènes comme CF3, etc.70
5
Par "aldéhyde" on entend ici des groupes -RCHO.
Par "alcool" on entend ici des groupes -OH et des alcools
alkyle -ROH.
Par "amido" on entend ici des groupes -RCONH- ou RCONR-.
Par "éthylèneglycol" ou "(poly)éthylèneglycol" on entend ici
un groupe '- (0-CH2-CH2) ^-, bien que chaque atome de carbone du
10 groupe ethylene puisse aussi être simplement ou doublement
substitué, par exemple - (0-CR2-CR2) n, R étant tel que décrit
ci-dessus. Les dérivés d'éthylèneglycol ayant d'autres
hétéroatomes à la place de l'oxygène (c'est-à-dire -(N-CH2-
CH2) n- ou - (S-CH2-CH2) n- ou des groupes de substitution) sont
15 aussi préférés.
Les groupes de substitution préférés comprennent, mais sans
s'y limiter, des groupes méthyle, éthyle, propyle, alcoxy
comme O- (CH2) 2-CH3- et O- (CH2) 4CH3 et éthylèneglycol et des
20 dérivés de celui-ci.
Les groupes aromatiques préférés comprennent, mais sans s'y
limiter, des groupes phényle, naphtyle, naphtalène,
anthracene, phénanthroline, pyrole, pyridine, thiophène, les
25 porphyrines, et les dérivés substitués de chacun de ceux-ci, y
compris les dérivés d'anneaux.
Dans les oligomères conducteurs représentés ici, quand g est
égal à 1, B-D est une liaison liant deux atomes ou groupes
30 caractéristiques chimiques. Dans un mode de réalisation
préféré, B-D est une liaison conjuguée, contenant des
orbitales tc conjugués ou superposables.
Les liaisons B-D préférées sont choisies parmi l'acétylène
35 (-C=C-, également appelé alcyne ou éthyne), l'alcène (-CH=CH-,
également appelé ethylene) , 1 ' alcène substitué <-CR-=CR-,
CH=CR- et -CR=CH-), l'amide (-NH-CO- et -NR-CO- ou -CO-NH- et71
-CO-NR-), l'azo (-N=N-), les esters et thioesters (-CO-0-, -0-
C0-, -CS-O- et -0-CS-) et d'autres liaisons conjuguées comme
(-CH=N-, -CR=N-, -N=CH- et -N-CR-), (-SiH=SiH-, SiR=SiH-, -
SiR=SiH-, et SiR=SiR-), (-SiH^CH-, -SiR=CH-, -SiH=CR-,
5 SiR=CR-, -CH=SiH-, ' -CR-=SiH-, -CH=SiR-, et -CR=SiR-) . Les
liaisons B-D particulièrement préférées sont l'acétylène,
1 ' alcène, 1'amide, et les dérivés substitués des trois, et
l'azo. Les liaisons B-D spécialement préférées sont
l'acétylène, l'alcène et l'amide. Des composants de
10 l'oligomère liés à des doubles liaisons peuvent avoir des
conformations trans ou cis ou des mélanges. Ainsi, soit B soit
D peut comprendre du carbone, de l'azote ou du silicium. Les
groupes de substitution sont tels que définis ci-dessus pour
R.
15
20
Quand g=0 dans l'oligomère conducteur de structure 1, e est de
préférence 1 et le groupe caractéristique D peut être un
groupe carbonyle ou un groupe caractéristique d'hétéroatome
comme défini ci-dessus.
Comme ci-dessus pour les anneaux Y, dans tout oligomère
conducteur simple, les liaisons B-D (ou les groupes
caractéristiques D quand g=0) peuvent être les mêmes, ou au
moins une peut être différente. Par exemple, quand m est zéro,
25 la liaison terminale B-D peut être une liaison amide, et le
reste des liaisons peuvent être des liaisons acétylène.
Généralement, quand les liaisons amide sont présentes, il est
préférable qu'il y ait le moins de liaisons amide possible,
mais dans certains modes de réalisation, toutes les liaisons
30 B-D sont des liaisons amide. Ainsi, comme expliqué brièvement
ci-dessus pour les anneaux Y, un type de liaisons B-D peut
être présent dans l'oligomère conducteur à l'intérieur d'une
couche monomoléculaire comme décrit ci-dessous, et un autre
type au-dessus du niveau de la couche monomoléculaire, par
35 exemple pour donner une meilleure flexibilité pour
l'hybridation de l'acide nucléique quand l'acide nucléique est
lié par l'intermédiaire d'un oligomère conducteur.72
Dans les structures représentées ici, m est un nombre entier
relatif de 1 à 50, bien que des oligomères plus longs peuvent
aussi être utilisés (voir par exemple Schumm et al., Angew.
5 Chem. Int. Ed. Engl. 1994 33 (13) : 1360) . Sans être fixé par
théorie, il apparaît que pour une hybridation efficace des
acides nucléiques sur une surface, l'hybridation doit avoir
lieu à une certaine distance de la surface, c'est-à-dire que
la cinétique de l'hybridation augmente en fonction de la
10 distance par rapport à la surface, particulièrement pour les
oligonucleotides longs de 200 à 300 paires de base. En
conséquence, quand un acide nucléique est lié par
l'intermédiaire d'un oligomère conducteur, tel que décrit de
manière plus précise ci-dessous, la longueur de l'oligomère
15 conducteur est telle que le nucleotide le plus près de l'acide
nucléique est positionné à environ 6 Â jusqu'à environ 100 A
(bien que des distances de plus de 500 Â peuvent être
utilisées) de l'électrode de surface, d'environ 15 Â à environ
60 K étant préféré et d'environ 25 Â à environ 60 Â étant
20 également préféré. En conséquence, m va dépendre de la taille
du groupe aromatique, mais généralement il va être d'environ 1
à environ 20, d'environ 2 à environ 15 étant préféré et
d'environ 3 à environ 10 étant spécialement préféré.
25 Dans les structures représentées ici, m est soit 0 soit 1.
C'est-à-dire, quand m est 0, l'oligomère conducteur peut se
terminer dans la liaison B-D ou le groupe caractéristique D,
c'est-à-dire que l'atome D est lié à l'acide nucléique soit
directement soit par l'intermédiaire d'un lieur. Dans certains
30 modes de réalisation, par exemple quand l'oligomère conducteur
est lié à un phosphate du squelette ribose phosphate d'un
acide nucléique, il peut y avoir des atomes supplémentaires,
comme un lieur, liés entre l'oligomère conducteur et l'acide
nucléique. En outre, comme expliqué brièvement ci-dessous,
35 l'atome D peut être l'atome azote uribose amino modifié. En
variante, quand m est 1, 1'oligomère conducteur peut terminer73
en Y, un groupe aromatique, c'est-à-dire que le groupe
aromatique est lié à l'acide nucléique ou au lieur.
Comme l'appréciera l'homme du métier, un grand nombre
5 d'oligomères conducteurs possibles peuvent être utilisés.
Ceux-ci comprennent les oligomères conducteurs entrant dans
les formules de structure 1 et de structure 8, comme d'autres
oligomères conducteurs, comme il est généralement connu dans
la technique, y compris par exemple des composés' comprenant
10 des anneaux aromatiques soudés ou des oligomères comme du
Téflon®, tout comme - (CF2)n-, - (CHF)n~ ' et - (CFR)n-- Voir par
exemple Schumm et al., Angew. Chem. Int. Ed. Engl.
33:1361(1994) ; Grosshenny et al., Platinum Metals Rev.
40(1) : 26-35 (1996) ; Tour, Chem. Rev. 96:537-553 (1996) ;
15 Hsung et al. , Organometallics 14:4808-4815 (1995 ; et les
références citées ici).
Les oligomères conducteurs particulièrement préférés de ce
mode de réalisation sont représentés ci-dessous :
20
Structure 2
La structure 2 est la structure 1 quand g est 1. Les modes de
réalisation préférés de la structure 2 comprennent : e et est
25 zéro, Y est le pyrrole ou le pyrole substitué ; e est zéro, Y
est le thiophène ; e est zéro, Y est un furanne ou un furanne
substitué ; e est zéro, Y est un phényle ou un phényle
substitué ; e est zéro, Y est la pyridine ou la pyridine
substituée ; e est 1, B-D est 1'acétylène et Y est le phényle
30 ou le phényle substitué (voir structure 4 ci-dessous). On
préfère un mode de réalisation de la structure 2 quand e est
un, représenté comme dans la structure 3 ci-dessous :74
Structure 3
Les modes de réalisation préférés de la structure 3 sont : Y
est le phényle ou le phényle substitué et B-D est azoïque ; Y
5 est le pnényle ou le phényle substitué et B-D est
l'acétylène ; Y est le phényle ou le phényle substitué et B-D
est l'alcène ; Y est la pyridine ou la pyridine substituée et
B-D est l'acétylène ; Y est le thiophène' ou le thiophène
substitué et B-D l'acétylène ; Y est le furanne ou le furanne
10 substitué et B-D est l'acétylène ; Y est le thiophène ou le
furanne (ou le thiophène ou le furanne substitué) et B-D sont
des liaisons alcène et acétylène alternantes.
La plupart des structures représentées ici utilisent un
15 oligomère conducteur de structure 3. Cependant, n'importe
lequel des oligomère de structure 3 peut être substitué avec
n'importe laquelle des autres structures représentées ici,
c'est-à-dire un oligomère de structure 1 ou 8, ou un autre
oligomère conducteur, et l'utilisation de la représentation de
20 la structure 3 n'a pas pour signification de limiter la portée
de l'invention.
Les modes de réalisation particulièrement préférés de la
structure 3 incluent les structures 4, 5, 6 et 7, représentées
25 ci-dessous :
Structure 4
Les modes de réalisation particulièrement préférés de la
structure 4 comprennent : n est égal à deux, m est égal à un
30 et R est un hydrogène ; n est égal à trois, m est égal à zéro
et R est un hydrogène ; et l'utilisation de groupes R augmente
la solubilité.75
Structure 5
10
15
20
Quand la liaison B^-D est une liaison amide, comme dans la
structure 5, les oligomères conducteurs sont des oligomères
pseudopeptides. Bien que la liaison amide dans la structure 5
soit représentée avec le carbonyle à gauche, c'est-à-dire
-CONH-, l'inverse peut aussi être utilisé, c'est-à-dire -NHCO-
. Les modes de réalisation particulièrement préférés de la
structure 5 comprennent : n est égal à deux, m est égal à un,
et R est un hydrogène ; n est égal à trois, m est égal à zéro,
et R est un hydrogène (dans ce mode de réalisation, l'azote
terminal (l'atome B) peut être l'azote de la ribose amino
modifié) ; et l'utilisation de groupes R pour augmenter la
solubilité.
Structure 6
Les modes de réalisation préférés de la structure 6
comprennent : le premier n est égal à deux, le second n est
égal à un, m est égal à zéro, et tous les groupes R sont des
hydrogènes, ou l'utilisation de groupes R pour augmenter la
solubilité.
25
30
Structure 7
Les modes de réalisation préférés de la structure 7
comprennent : le premier n est égal à trois, le second n est
de 1 à 3, m étant soit 0 soit 1, et l'utilisation de groupes R
pour augmenter la solubilité.76
Dans un mode de réalisation préféré, l'oligomère conducteur a
la structure représentée dans la structure 8 :
Structure 8
Dans ce mode de réalisation, C sont des atomes de carbone, n
et un membre entier relatif de 1 à 50, m est 0 ou 1, J est un
hétéroatome sélectionné parmi le groupe contenant de
l'oxygène, de l'azote, du silicium, du phosphore, du sulfure,
10 du carbonyle ou du sulfoxyde, et G est une liaison
sélectionnée parmi alcane, alcène ou acétylène, de manière à
ce que conjointement avec les deux atomes de carbone, le
groupe C-G-C est un alcène (-CH=CH-), alcène substitué (-
CR=CR-) ou des mélanges de ceux-ci (-CH=CR ou -CR=CH-),
15 acétylène (-C=C-) , ou alcane (-CR2-CR2-, R étant soit un
hydrogène soit un groupe de substitution tel que décrit ici).
La liaison G de chaque sous-unité peut être la même ou
différente des liaisons G ou d'autres sous-unités. C'est-à-
dire qu'on peut alterner les oligomères de liaisons alcène et
20 de liaisons acétylène, etc. Cependant, quand G est un alcane,
le nombre de liaisons alcane dans l'oligomère doit être réduit
à un minimum, environ six liaisons sigma ou moins par
oligomère conducteur étant préférées. Les liaisons alcène sont
préférées, et sont généralement représentées ici, bien que les
25 liaisons alcane et acétylène peuvent être substituées dans
n'importe quelles structure ou mode de réalisation décrits ici
comme l'appréciera l'homme du métier.
Dans certains modes de réalisation, par exemple, quand les ETM
30 ne sont pas présentes, si m=0 alors au moins une des liaisons
G n'est pas une liaison alcane.
Dans un mode de réalisation préféré, le m de la structure 8
est zéro. Dans un mode dé réalisation particulièrement
35 préféré, m est zéro et G est une liaison alcène, comme
représenté dans la structure 9 :77
Structure 9
R
1'oligomère*alcène de la structure 9, et d'autres représentés
5 ici, sont généralement représentés dans la configuration trans
préférée, bien que les oligomères de configuration cis ou de
mélange de trans et cis peuvent aussi être utilisés. Comme ci-
dessus, les groupes R peuvent être ajoutés afin de modifier
l'emballage des compositions d'une électrode, le caractère
10 hydrophile ou hydrophobe de l'oligomère, et la flexibilité,
c'est-à-dire la flexibilité longitudinale, rotationnelle, ou
tortionnelle de l'oligomère. n est comme décrit ci-dessus.
Dans un mode de réalisation préféré, R est l'hydrogène, bien
15 que R puisse aussi être des groupes alkyle et des
polyéthylèneglycols ou leurs dérivés.
Dans un mode de réalisation en variante, l'oligomère
conducteur peut être un mélange de différents types
20 d'oligomères, par exemple des structures 1 et 8.
Les oligomères conducteurs peuvent ou pas avoir de groupes
terminaux, ainsi, dans un mode de réalisation préféré, il n'y
a pas de groupe terminal supplémentaire, et l'oligomère
25 conducteur se termine avec l'un des groupes représentés dans
les structures 1 à 9 ; par exemple, une liaison B-D telle
qu'une liaison acétylène. En variante, dans un mode de
réalisation préféré, un groupe terminal est ajouté, parfois
représenté ici comme "Q". Un groupe terminal peut être utilisé
30 pour de nombreuses raisons ; par exemple, pour contribuer à la
disponibilité électrique de l'oligomère conducteur pour la
détection des ETM, ou pour altérer la surface de la SAM pour
d'autres raisons, par exemple pour empêcher une fixation non
spécifique. Par exemple, quand l'analyte cible est un acide
35 nucléique, il peut y avoir des groupes chargés négativement78
sur le terminus pour former une surface chargée négativement
de manière à ce que, quand l'acide nucléique est un ADN ou un
ARN, l'acide nucléique soit repoussé ou empêché de se déposer
sur la surface, pour faciliter l'hybridation. Les groupes
5 terminaux préférés '" comprennent -NH2, -OH, -COOH, et des
groupes alkyle tel que -CH3, et des oxydes de (poly)alkyle
tels du ('poly) éthylèneglycol, -OCH2CH2OH, - (OCH2CH20) 2H,
(OCH2CH20)3H, et - (OCH2CH20) 4H étant préférés.
10 Dans un mode de réalisation préféré, "il est possible
d'utiliser des mélanges d'oligomères conducteurs avec
différents types de groupes terminaux, ainsi, par exemple,
certains des groupes terminaux peuvent faciliter la détection,
et certains peuvent empêcher une fixation non spécifique.
15
On appréciera que la couche monomoléculaire puisse comprendre
différentes espèces d'oligomères conducteurs, bien que de
préférence, les espèces différentes soient choisies de manière
à ce qu'une SAM raisonnablement uniforme puisse être formée.
20 Ainsi, par exemple, quand des ligands de fixation de capture
comme des acides nucléiques sont liés de manière covalente à
l'électrode utilisant des oligomères conducteurs, il est
possible d'avoir un type d'oligomére conducteur utilisé pour
lier l'acide nucléique, et un autre type dans la SAM. De
25 manière similaire, il peut être souhaitable d'avoir des
mélanges de différentes longueurs d'oligomères conducteurs
dans la couche monomoléculaire, pour aider à réduire des
signaux non spécifiques. Ainsi, par exemple, des modes de
réalisation préférés utilisent des oligomères conducteurs qui
30 se terminent sous la surface du reste de la couche
monomoléculaire, c'est-à-dire en dessous de la couche
d'isolateur, si elle est, utilisée ou sous une certaine
fraction des autres oligomères conducteurs. De manière
similaire, l'utilisation de différents oligomères conducteurs
35 peut être effectuée pour faciliter la formation de couches
monomoléculaires, ou pour faire des couches monomoléculaires
avec des propriétés altérées.79
10
15
35
Dans un mode de réalisation préféré, la couche monomoléculaire
peut comprendre en plus des groupes caractéristiques
d'isolateurs. Par "isolateur" on entend ici un oligomère
essentiellement non conducteur, de préférence linéaire. Par
"essentiellement non conducteur" on entend ici que l'isolateur
ne va pas transférer d'électrons en 100 Hz. Le taux de
transfert d'électrons au travers de 1'isolateur est de
préférence plus lent que le taux au travers des oligomères,
conducteurs décrits ici.
Dans un mode de réalisation préféré,- les isolateurs ont une
conductivité S d'environ 10~7 Q"1cm"1 ou inférieure, moins
d'environ 10~8 Q~1cm"1 étant préféré. Voir en général Gardner et
al., supra.
De manière générale, les isolateurs sont des oligomères alkyle
ou hétéroalkyle ou des groupes caractéristiques ayant des
liaisons sigma, bien que toute molécule d'isolateur
particulière peut contenir les groupes aromatiques ou une ou
20 plusieurs liaisons conjuguées. Par "hétéroalkyle" on entend
ici un groupe alkyle qui a au moins un hétéroatome, c'est-à-
dire l'azote, l'oxygène, le sulfure, le phosphore, le silicium
ou le bore compris dans la chaîne. En variante, l'isolateur
peut être assez similaire à un oligomère conducteur avec
25 1'ajout d'un ou plusieurs hétéroatomes ou liaisons qui servent
à empêcher ou à ralentir, de préférence sensiblement, le
transfert d'électrons.
Les isolateurs convenables sont connus dans la technique, et
30 comprennent, mais sans s'y limiter, -(CH2)n~r -(CHR)n-/ et , -
(CR2)n-/ de l'éthylèneglycol ou dérivés utilisant d'autres
hétéroatomes à la place de l'oxygène, c'est-à-dire, de l'azote
ou du sulfure (des dérivés de sulfure ne sont pas préférés
quand l'électrode est en or).
Comme pour les oligomères conducteurs, les isolateurs peuvent
être substitués par des groupes R comme défini ici pour80
10
altérer 1'emballage des groupes caractéristiques ou des
oligomères conducteurs sur une électrode, le caractère
hydrophile ou hydrophobe de 1 * isolateur, et la flexibilité,
c'est-à-dire la flexibilité longitudinale, rotationnelle, ou
tortionnelle, de 1 'isolateur. Par exemple, des groupes alkyle
ramifiés peuvent être utilisés. De manière similaire, les
isolateurs peuvent contenir des groupes terminaux, comme
expliqué brièvement ci-dessous, en particulier pour influencer
la surface-de la couche monomoléculaire.
La longueur des espèces composant la couche monomoléculaire va
varier si nécessaire. Comme expliqué brièvement ci-dessous, il
apparaît que la fixation des analytes cibles (par exemple,
hybridation des acides nucléiques), est plus efficace à une
15 certaine distance de la surface. Les espèces auxquelles les
ligands de fixation de capture sont liés (comme expliqué
brièvement ci-dessous, ceux-ci peuvent être soit des
isolateurs soit des oligomères conducteurs) peuvent être
fondamentalement de la même longueur que les espèces formant
20 la couche monomoléculaire, ou plus longues que celles-ci, ce
qui a pour résultat que les ligands de fixation de capture
sont moins accessibles aux solvants pour l'hybridation. Dans
certains modes de réalisation, les oligomères conducteurs
auxquels les ligands de fixation de capture sont attachés
25 peuvent être plus courts que la couche monomoléculaire.
Comme l'appréciera l'homme du métier, les combinaisons et les
rapports réels des espèces différentes composant la couche
monomoléculaire peuvent varier largement, et vont dépendre du
30 mécanisme utilisé, le mécanisme 1 ou le mécanisme 2, et dans
le cas de I'électrophorèse, vont dépendre du système utilisé,
s'il s'agit d'un système à une électrode ou à deux électrodes,
comme il est expliqué avec plus de précision ci-dessous. En
général, trois systèmes de composants sont préférés pour les
35 systèmes de mécanisme 2, les premières espèces comprenant un
ligand de fixation de capture contenant des espèces (nommées
sonde de capture quand l'analyte cible est un acide81
nucléique), liées à l'électrode par l'intermédiaire soit d'un
isolateur soit d'un oligomère conducteur. Les deuxièmes
espèces sont des oligomères conducteurs, et les troisièmes
espèces sont des isolateurs. Dans ce mode de réalisation, les
5 premières espèces peuvent en comprendre d'environ 90 % à
environ 1 %, d'environ 20 % à environ 40 % étant préférées.
Quand les analytes cibles sont des acides nucléiques,
d'environ 30 % à environ 40 % et spécialement préférés pour
des courtes cibles oligonucleotides et d'environ 10 % à
10 environ 10 % est préféré pour des cibles plus longues. Les
deuxièmes espèces peuvent en comprendre d'environ 1 % à
environ 90 %, d'environ 20 % à environ 90 % étant préférées,
et d'environ 40 % à environ 60 % étant spécialement préférées.
Les troisièmes espèces peuvent comprendre d'environ 1 % à
15 environ 90 %, d'environ 20 % à environ 40 % étant préférées,
et d'environ 15 % à environ 30 % étant spécialement préférés.
Pour atteindre ces proportions approximatives, des rapports
préférés des espèces première : deuxième : troisième dans les
solvants de formation SAM sont 2:2:1 pour les cibles courtes,
20 1:3:1 pour les cibles plus longues, la concentration thiol
totale (quand utilisée pour lier ces espèces, comme défini de
manière plus précise ci-dessous) 500 pM à 1 mM, et 833 pM
étant préférés.
25 En variante, deux systèmes de composants peuvent être
utilisés. Dans un mode de réalisation, pour l'utilisation dans
des systèmes de mécanisme 1 ou de mécanisme 2, les deux
composants sont la première et la deuxième espèces. Dans ce
mode de réalisation, la première espèce peut comprendre
30 d'environ 1 % à environ 90 %, d'environ 1 % à environ 40 %
étant préféré, et d'environ 10 % à environ 40 % étant
spécialement préféré. La deuxième espèce peut en comprendre
d'environ 1 % à environ 90 %, d'environ 10 % à environ 60 %
étant préférée, et d'environ 20 % à environ 40 % étant
35 spécialement préférée. En variante, pour les systèmes de
mécanisme 1, les deux composants sont la première et la
troisième espèces. Dans ce mode de réalisation, la première82
espèce peut en comprendre d'environ 1 % à environ 90 %,
d'environ 1 % à environ 40 % étant préférés, et d'environ 10 %
à environ 40 % étant spécialement préférés. La deuxième espèce
peut en comprendre d'environ 1 % à environ 90 %, d'environ 10
5 % à environ 60 % étant préférés, et d'environ 20 % à environ
40 % étant spécialement préférés.
Dans un mode de réalisation préféré, la déposition de la S/AM
est effectuée en utilisant des solvants aqueux. Comme il est
10 décrit de manière générale dans Steel et' al. Anal. Chem.
70:4670 (1998), Herne et al. J. Am. Chem. Soc. 119:8916(1997),
and Finklea, Electrochemistry of Organized Monolayers of
Thiols and Related Molecules on Electrodes, de A.J. Bard,
Electroanalytical Chemistry : A Series of Advances, Vol.20,
15 Dekker N.Y. 1966, la déposition des espèces formant la STAM
peut être effectuée hors des solutions aqueuses, comprenant
fréquemment du sel.
De plus, quand les systèmes d'éléments sont utilisés, la
20 composition et 1 'intégrité de la couche monomoléculaire peut
dépendre du système utilisé, selon s'il s'agit d'un système à
une électrode ou à deux électrodes. Ainsi, par exemple, si un
système à une électrode est utilisé pour à la fois
I'électrophorèse et la détection, la configuration du système
25 va permettre au transporteur de charge électroactive, si
utilisé, d'accéder à l'électrode. Comme l'appréciera l'homme
du métier, si la" chimie de liaison de l'oligomère conducteur
est stable aux hauts voltages utilisés pour hydrolyser l'eau,
aucun transporteur de charge électroactive n'est nécessaire.
30 Ceci peut être effectué de nombreuses manières différentes.
Dans un mode de réalisation préféré, la couche monomoléculaire
comprend un composant significatif des oligomères conducteurs
exposés électroniquement ; une couche monomoléculaire de telle
que celle-ci élève efficacement la surface de l'électrode,
35 permettant au transporteur de charge électroactive d'obtenir
un accès indirect à l'électrode. En variante, une couche
monomoléculaire pauvre peut être utilisée, c'est-à-dire une83
couche monomoléculaire qui contient "des trous d'épingles" ou
"des imperfections", de manière à ce qu'il y ait un accès
direct du solvant à l'électrode. En variante, la configuration
de l'électrode peut être de telle manière que moins de la
surface entière de 'l'électrode soit recouverte par une SAM,
pour permettre un accès direct à l'électrode, mais en
m-
minimisant la surface pour une fixation non spécifique.
10
15
20
25
30
La liaison covalente des oligomères conducteurs et des
isolateurs à l'électrode peut être accomplie" selon une variété
de moyens différents, ou dépend de- l'électrode et de la
composition des isolateurs et des oligomères conducteurs
utilisés. Dans un mode de réalisation préféré, les lieurs de
liaisons avec des nucleosides ou des acides nucléiques liés de
manière covalente, comme représenté ici, sont liés de manière
covalente à une électrode. Ainsi, un bout ou terminus du lieur
de liaison est lié à l'acide nucléique ou au nucleoside, et
l'autre est lié à une électrode. Dans certains modes de
réalisation, il peut être souhaitable que le lieur de liaison
soit lié à une position autre qu'un terminus, ou même qu'un
lieur de liaison ramifié soit lié à une électrode à un
terminus et à deux nucleosides ou plus à d'autres terminus,
bien que ceux-ci ne soient pas préférés. De manière similaire,
le lieur de liaison peut être lié à deux sites à l'électrode,
comme généralement représenté dans les structures 11-13. De
manière générale, on utilise un type de lieur, comme décrit
ci-dessous tel que "A"
1'oligomère conducteur,
hachurée est l'électrode
dans la structure 10,
ou
'X'
est
I" est un isolateur et la surface
84
Dans ce mode de réalisation, A est un lieur ou un atome. Le
choix de "A" va dépendre en partie des caractéristiques de
l'électrode. Ainsi, par exemple, A peut être un groupe
caractéristique de sulfure quand une électrode en or est
5 utilisée. En variante, quand les électrodes d'oxyde de métal
sont utilisées, A peut être un groupe caractéristique de
silicium (silane) lié à l'oxygène de l'oxyde (voir par exemple
Chen et al., Langmuir 10:3332-3337 (1994) ; Lenhard et al., J.
Electroanal. Chem. 78:195-201 (1977). Quand des électrodes
10 basées sur du carbone sont utilisées, A peut être un groupe
caractéristique amino (de préférence un amine primaire ; voir
par exemple Deinhammer et al., Langmuir 10:1306-1313 (1994)) .
Ainsi, les groupes caractéristiques A préférés comprennent,
mais sans s'y limiter, des groupes caractéristiques de silane,
15 des groupes caractéristiques de sulfure (y compris des groupes
caractéristiques de sulfure alkyle), et des groupes amino.
Dans un mode de réalisation préféré, les liaisons types
époxyde ayant des polymères redox connus dans la technique ne
sont pas utilisées.
20
Bien que représenté ici comme un groupe caractéristique
simple, les isolateurs et les oligomères conducteurs peuvent
être liés à l'électrode avec plus d'un groupe caractéristique
"A" ; les groupes caractéristiques "A" peuvent être les mêmes
25 ou différents. Ainsi, par exemple, quand l'électrode est une
électrode en or, et "A" est un atome de soufre ou un groupe
caractéristique, des atomes de soufre multiples peuvent être
utilisés pour lier l'oligomère conducteur à l'électrode, comme
généralement représenté ci-dessous dans les structures 11, 12
30 et 13. Comme 1'appréciera l'homme du métier, d'autres
structures telles que celles-ci peuvent être effectuées. Dans
les structures 11, 12 et 13, le groupe caractéristique A est
juste un atome de soufre, mais des groupes caractéristiques de
soufre substitués peuvent aussi être utilisés.85
Structure 11
/
/'
/
. Xoul
Structure 12
A
S-w R
«^- Xoul
Structure 13
Xoul
Il faut aussi noter que de manière similaire à la structure
10 13, il peut être possible d'avoir un oligomère conducteur
terminant avec un seul atome de carbone avec trois groupes de
soufre liés à l'électrode. En outre, bien que pas toujours
représenté ici, les oligomères conducteurs et les isolateurs
peuvent aussi comprendre un groupe terminal "Q".
15
Dans un mode de réalisation préféré, l'électrode est une
électrode en or, et la liaison se fait par 1 ' intermédiaire
d'une liaison sulfure comme il est bien connu dans la
technique, c'est-à-dire que le groupe caractéristique A est un
20 atome de soufre ou un groupe caractéristique. Bien que les
caractéristiques exactes de la liaison hors soufre ne soient
pas connues, cette liaison est considérée comme covalente pour
les buts de cette invention. Une structure représentative est
représentée dans la structure 14, en utilisant l'oligomère
25 conducteur de la structure 3, bien que comme pour toutes les
structures représentées ici, n'importe lequel des oligomères
conducteurs, ou combinaisons des oligomères conducteurs, peut86
être utilisé. De manière similaire, n'importe lequel des
oligomères conducteurs ou des isolateurs peut aussi comprendre
des groupes terminaux comme décrit ici. La structure 14
représente le lieur "A" comme comprenant juste un atome de
5 soufre, bien que des atomes supplémentaires puissent être
présent (c'est-à-dire des lieurs du soufre à 1'oligomère
conducteur ou au groupe de substitution). En outre, la
structure 14 montre l'atome de soufre lié au groupe aromatique
Y, mais comme l'appréciera l'homme du métier, il peut aussi
10 être lié au groupe B-D (c'est-à-dire un acétylène).
Structure 14
En général, les liaisons thiol sont préférées. Dans les
15 systèmes utilisant I'électrophorèse, les liaisons thiol sont
préférées quand soit deux sets d'électrodes sont utilisés
(c'est-à-dire que les électrodes de détection comprenant les
SAM ne sont pas utilisées à hauts voltages électrophorétiques
(c'est-à-dire supérieurs à 800 ou 900 mV) qui peuvent causer
20 l'oxydation de la liaison thiol et ainsi une perte de la SAM),
ou soit, si un set d'électrode est utilisé, des voltages
électrophorétiques plus bas sont utilisés, comme généralement
décrit ci-dessous.
25 Dans un mode de réalisation préféré, 1 ' électrode est une
électrode de carbone, c'est-à-dire une électrode de carbone
lisse, et la liaison se fait par l'intermédiaire d'un azote
d'un groupe amine. Une structure représentative est
représentée dans la structure 15. A nouveau, des atomes
30 supplémentaires peuvent être présents, c'est-à-dire des lieurs
de type Z et/ou des groupes terminaux.87
Structure 15
A
/
/
/
?s-f"???°:K<)?
/
/
/
/
Structure 16
?°?^v-*-°^t-
Dans la structure 16, l'atome d'oxygène vient de l'oxyde de
l'électrode d'oxyde de métal. L'atome Si peut aussi contenir
d'autres atomes, c'est-à-dire être un groupe caractéristique
de silicium contenant des groupes de substitution. D'autres
10 liaisons pour des SAM à d'autres électrodes sont connues dans
le métier ; voir par exemple Napier et al., Langmuir, 1997,
pour la liaison des électrodes d'oxyde d'étain indium, et
aussi la chémisorption de phosphate vers une électrode d'oxyde
d'étain indium (propos par H. Holden Thorpe, CHI conference,
15 4 et 5 Mai 1998) .
Les SAM de l'invention peuvent être effectués selon une grande
variété de moyens, y compris la déposition hors des solutions
organiques et la déposition hors des solutions aqueuses. Les
20 propos expliqués brièvement ici utilisent une électrode en or
en tant qu'exemple, bien que comme 1'appréciera 1'homme du
métier, d'autres métaux et d'autres procédés peuvent être
aussi utilisés. Dans un mode de réalisation préféré, l'oxyde
d'étain indium (ITO) est utilisé comme l'électrode.
25
Dans un mode de réalisation préféré, une surface en or est
tout d'abord nettoyée. Une variété de procédures de nettoyages
peuvent être employés, y compris, mais sans s'y limiter, des
nettoyants chimiques ou des décapants (y compris la solution
30 Piranha (peroxyde d'hydrogène/acide sulfurique) ou eau régale
(acide chlorhydrique/acide nitrique), procédé électrochimique,88
traitement par flamme, traitement par plasma ou les
combinaisons de ceux-ci.
A la suite du nettoyage, le substrat en or est exposé aux
5 espèces de S7AM. Quand 1 ' électrode est ITO, les espèces SAM
sont les espèces contenant du phosphonate. Ceci peut aussi
être effectué selon une variété de moyens différents, y
compris, mais sans s ' y limiter, une déposition de solution,
une déposition par phase gazeuse, une impression par
10 microcontact, une déposition par pulvérisation, une déposition
en utilisant des composants purs, etc. Un mode de réalisation
préféré utilise une solution de déposition comprenant un
mélange d'espèces SAM variées en solution, généralement des
espèces contenant du thiol. Les couches monomoléculaires
15 mélangées qui contiennent des analytes cibles,
particulièrement de l'ADN, sont habituellement préparées en
utilisant une procédure en deux étapes. L'ADN thiolé est
déposé au cours de la première étape de déposition
(généralement en présence d'au moins une autre espèce
20 composant la couche monomoléculaire) et la formation de la
couche monomoléculaire mélangée est complétée au cours de la
deuxième étape dans laquelle une seconde solution thiol sans
l'ADN est ajoutée. La seconde étape peut impliquer un
chauffage léger pour promouvoir la réorganisation de la couche
25 monomoléculaire, bien que ceci ne soit pas préféré dans tous
les modes de réalisation.
Dans un mode de réalisation préféré, la solution de déposition
est une solution de déposition organique. Dans ce mode de
30 réalisation, une surface en or propre est placée dans un
flacon propre. Une solution de déposition de ligand de
fixation dans un solvant organique est préparée, dans laquelle
la concentration en thiol totale est entre micromolaire et
saturation ; les gammes préférées comprennent d'environ 1 pm à
35 10 mM, d'environ 4 00 pM à environ 1,0 mM étant spécialement
préférées. Dans un mode de réalisation préféré, la solution de
disposition contient de l'ADN modifié thiol (c'est-à-dire de89
l'acide nucléique lié à un lieur de liaison) et des molécules
de diluant thiol (soit des oligomères conducteurs soit des
isolateurs, ces derniers étant préférés). Le rapport
ADN/diluant (si présent) est habituellement entre 1000:1 et
5 1:1000, d'environ l'O: 1 à environ 1:10 étant préféré et 1:1
étant spécialement préféré. Les solvants préférés sont le
tétrahydrofuranne (THF), 1'acétonitrile, le diméthylforamide
(DMF), l'éthanol, ou des mélanges de ceux-ci ; en général
n'importe -quel solvant de polarité suffisante pour dissoudre
10 le ligand de capture peut être utilisé, tant que le solvant
est dépourvu de groupes fonctionnels -qui vont réagir avec la
surface. La solution de déposition d'ADN suffisante est
ajoutée au flacon de manière à recouvrir complètement la
surface de l'électrode. Le substrat d'or peut alors incuber à
15 température ambiante ou légèrement au-dessus de la température
ambiante pour une période de temps allant de quelques secondes
à des heures, de préférence de 5 à 30 minutes. Après
l'incubation initiale, la solution de déposition est enlevée
et une solution de molécules de diluant seulement (d'environ 1
20 pM à 10 mM, de préférence d'environ 100 pM à environ 1,0 mM)
dans un solvant organique et ajoutée. Le substrat en or peut
alors incuber à température ambiante ou au-dessus de la
température ambiante pour une période de temps (de quelques
secondes à plusieurs jours, de préférence d'environ 10 minutes
25 à environ 24 heures). L'échantillon en or est enlevé de la
solution, rincé avec un solvant propre et utilisé.
Dans un mode de réalisation préféré, une solution de
déposition aqueuse est utilisée. Comme ci-dessus, une surface
30 en or propre est placée dans un flacon propre. Une solution de
déposition d'ADN dans l'eau est préparée dans laquelle la
concentration totale thiol est entre environ 1 pm et 10 mM, de
préférence d'environ 1 pM à environ 200 pM. La solution
aqueuse a fréquemment du sel (jusqu'à saturation,
35 approximativement 1 M étant préféré), cependant l'eau pure
peut être utilisée. La solution de déposition contient de
l'ADN modifié thiol et souvent une molécule de diluant thiol.90
Le rapport ADN/diluant est habituellement entre 1000:1 et
1:1000, d'environ 10:1 à environ 1:10 étant préféré et 1:1
étant spécialement préféré. La solution de déposition de l'ADN
est ajoutée au flacon dans un volume tel qu'elle recouvre la
5 surface de 1'électrode. Le substrat en or peut incuber à
température ambiante ou légèrement au-dessus de la température
0
ambiante pendant 1 à 30 minutes, 5 minutes étant
habituellement suffisantes. Après l'incubation initiale, la
solution de déposition est enlevée et une solution de molécule
10 de diluant seulement (10 pM-1,0 mM) dans soit de l'eau soit un
solvant organique est ajoutée. Le substrat en or peut incuber
à température ambiante ou au-dessus de la température ambiante
jusqu'à ce qu'une couche monomoléculaire complète soit formée
(10 minutes à 24 heures). L'échantillon en or est enlevé de la
15 solution, rincé avec un solvant clair et utilisé.
Dans un mode de réalisation préféré, comme expliqué brièvement
ici, une carte à circuit imprimé est utilisée en tant que
substrat pour les électrodes en or. La formation des SAM sur
20 la surface en or est généralement effectuée en nettoyant tout
d'abord les cartes, par exemple dans une solution d'acide
sulfurique 10 % pendant 30 secondes, les solutions de
détergent, de l'eau régale, du plasma, etc. comme expliqué
brièvement ici. A la suite du traitement par l'acide
25 sulfurique, les cartes sont lavées, par exemple par
l'intermédiaire d'une immersion dans deux bains d'eau Milli-Q
pendant 1 minute chacun. Les cartes sont alors séchées, 'par
exemple sous un courant d'azote. Le repérage de la solution de
déposition sur les cartes est effectué en utilisant n'importe
30 quel nombre de systèmes connus de repérage, généralement en
plaçant les cartes sur une table X-Y, de préférence dans une
chambre humide. La taille de la goutte de repérage va varier
avec la taille des électrodes sur les cartes et l'équipement
utilisé pour la livraison de la solution ; par exemple pour
35 des électrodes d'une taille de 250 pM, une goutte de 30
nanolitres est utilisée. Le volume doit être suffisant pour
recouvrir complètement la surface de l'électrode. La goutte91
est incubée à température ambiante pendant une période de
temps (d'une seconde à toute la nuit), 5 minutes étant
préférées et alors la goutte est enlevée en rinçant dans un
bain-marie Milli-Q. Les cartes sont alors traitées de
5 préférence avec une -"seconde solution de déposition, comprenant
généralement un isolateur dans un solvant organique, de
préférence de l'acétonitrile, par immersion dans un bain à
45 °C. Après 30 minutes, les cartes sont enlevées et immergées
dans un bain d'acétonitrile pendant 30 secondes suivi d'un
10 bain-marie Milli-Q pendant 30 secondes. 'Les cartes sont
séchées sous un courant d'azote.
Dans mode de réalisation préféré, l'électrode de détection
comprend en plus un ligand de fixation de capture, de
15 préférence lié de manière covalente. Par "ligand de fixation"
ou " espèce de fixation" on entend ici un composé qui est
utilisé pour prouver la présence de l'analyte cible, qui va se
fixer à l'analyte cible. En général, pour la plupart des modes
de réalisation décrits ici, il y a au moins deux ligands de
20 fixation utilisés par molécule d'analyte cible ; un ligand de
fixation "capture" ou "ancre" (auquel on fait aussi référence
ici sous le terme de "sonde de capture", particulièrement en
référence au ligand de fixation de l'acide nucléique) qui est
lié à l'électrode comme décrit ici, et un ligand de fixation
25 soluble, qui se fixe indépendamment à l'analyte cible, et il
comprend soit directement soit indirectement une ETM.
En général, le ligand de fixation de capture permet la liaison
d'une analyte cible à l'électrode de détection, pour les buts
30 de la détection. Comme il est expliqué de manière plus précise
ci-dessous, la liaison de l'analyte cible au ligand de
fixation de capture peut être directe (c'est-à-dire que
l'analyte cible se fixe au ligand de fixation de capture) ou
indirecte (on peut utiliser un ou plusieurs ligands extendeurs
35 de capture).92
Dans un mode de réalisation préféré, la fixation est
spécifique, et le ligand de fixation est une partie de la
paire de fixation. Par "fixation spécifique" on entend ici que
le ligand se fixe à l'analyte, avec une spécificité suffisante
5 pour faire la différence entre 1'analyte et d'autres
composants ou contaminants de l'échantillon test. Cependant
comme 1'appréciera 1'homme du métier, il sera possible de
détecter des analytes en utilisant une fixation qui n'est pas
hautement ' spécifique ; par exemple, les systèmes peuvent
10 utiliser différents ligands de fixation, par" exemple une gamme
de ligands différents, et la détection de n'importe quel
analyte particulier se fait par 1'intermédiaire de sa
"signature" de fixation à une liste de ligands de fixation, de
la même manière que les "analyseurs d'odeur". La fixation doit
15 être suffisante pour permettre à l'analyte de rester fixée
dans les conditions du dosage, y compris les étapes de
nettoyage pour enlever la fixation non spécifique. Dans
certains modes de réalisation, par exemple dans la détection
de certains biomolécules, les constantes de fixation de
20 1'analyte au ligand de fixation vont être au moins d'environ
10"4 à 10"6M_1, au moins environ IO"5 à 10"9 étant préféré et au
moins environ 10"7 à 10"9M_1 étant particulièrement préféré.
Comme 1'appréciera 1'homme du métier, la composition du ligand
25 de fixation va dépendre de la composition de l'analyte cible.
Les ligands de fixation à large variété d'analytes sont connus
ou peuvent être facilement connus en utilisant les techniques
connues. Par exemple, quand 1'analyte est un acide nucléique
simple brin, le ligand de fixation est généralement
30 essentiellement un acide nucléique complémentaire. En
variante, comme décrit généralement dans les brevets des
Etats-Unis 5 270 163, 5 475 096, 5 567, 588, 5 595 877, 5 637
459, 5 683 867, 5 705 337 et brevets apparentés, des
"aptamères" d'acide nucléique peuvent être développés pour la
35 fixation à pratiquement n'importe quel analyte cible. De
manière .similaire, l'analyte peut être une protéine de
fixation d'acide nucléique et le ligand de fixation de capture93
est soit un acide nucléique simple brin soit un acide
nucléique double brin ; en variante, le ligand de fixation
peut être une protéine de fixation d'acide nucléique quand
l'analyte est un acide nucléique simple brin ou double brin.
5 Quand l'analyte est une protéine, les ligands de fixation
comprennent des protéines (y compris en particulier des
anticorps ou des fragments de ceux-ci (F/Abs, etc.)), des
petites molécules, ou des aptamères, décrits ci-dessus. Des
protéines 'de ligands de fixation préférées comprennent des
10 peptides. Par exemple, quand l'analyte est" une enzyme, des
ligands de fixation convenables comprennent des substrats, des
inhibiteurs et d'autres protéines qui fixent l'enzyme, c'est-
à-dire des composants d'un complexe multi-enzymes (ou
protéines). Comme l'appréciera l'homme du métier, n'importe
15 laquelle des deux molécules qui va s'associer, de préférence
spécifiquement, peut être utilisée, soit comme analyte soit
comme le ligand de fixation. Des paires convenables
d'analyte/ligand de fixation comprennent, mais sans s'y
limiter, des anticorps/antigènes, des récepteurs/ligands, des
20 protéines/acides nucléiques ; des acides nucléiques/acides
nucléiques, des enzymes/substrats et/ou inhibiteurs, des
hydrates de carbone (y compris des glycoprotéines et des
glycolipides)/lectines, des hydrates de carbone et d'autres
partenaires de fixation, des protéines/protéines, et des
25 protéines/petites molécules. Ceux-ci peuvent être des
séquences de type large ou des séquences dérivées. Dans un
mode de réalisation préféré, les ligands de fixation sont des
parties (en particulier des parties extracellulaires) de
récepteurs de surface cellulaire qui sont connus à
30 multimériser, comme le récepteur d'hormone de croissance, les
transporteurs de glucose (en particulier le récepteur GLUT4),
le récepteur de transferrine, le récepteur de facteur de
croissance épidermique, le récepteur de lipoprotéine de faible
densité, le récepteur de lipoprotéine de haute densité, le
35 récepteur de leptine, les récepteurs d'interleukine y compris
les récepteurs IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-11, IL-12, IL-13, IL-15 et IL-17, le récepteur à94
VEGF, le récepteur à PDGF, le récepteur à EPO, le récepteur à
TPO, le récepteur du facteur neurotrophique ciliaire, le
récepteur de prolactine, et les récepteurs des lymphocytes T.
De manière similaire, il existe de nombreux ouvrages
5 concernant le développement des partenaires de fixation basé
sur des procédés de chimie combinatoire.
??
Dans ce mode de réalisation, quand le ligand de fixation est
un acide ' nucléique, des compositions et des techniques
10 préférées sont expliquées brièvement dans 'les documents WO
98/20162 ; PCT/US98/12430 ; PCT/US98/12082 ; PCTUS99/01705 ;
PCT/US99/01703 ; et U.S.S.N 09/135 183 ; 60/105 875 et
09/295 691.
15 Le procédé de liaison des ligands de fixation de capture au
lieur de liaison (soit un isolateur soit un oligomère
conducteur) va généralement être effectué comme connu dans la
technique et va dépendre à la fois de la composition du lieur
de liaison et du ligand de fixation de capture. En général,
20 les ligands de fixation de capture sont liés au lieur de
liaison par 1'utilisation sur chacun de groupes fonctionnels
qui peuvent alors être utilisés pour la liaison. Ces groupes
fonctionnels préférés pour la liaison sont des groupes amino,
des groupes carboxy, des groupes oxo et des groupes thiol. Les
25 groupes peuvent alors être liés, soit directement soit
indirectement par l'utilisation d'un lieur, parfois représenté
ici par "Z". Les lieurs sont bien connus dans la technique ;
par exemple, les homo ou hétéro lieurs bifonctionnels comme il
est bien connu (voir le catalogue 1994 Pierce Chemical
30 Company, section technique sur les lieurs croisés, pages 155 à
200). Les lieurs Z préférés comprennent, mais sans s'y
limiter, des groupes alkyle (y compris des groupes alkyle
substitués et des groupes alkyle contenant des groupes
caractéristiques d'hétéroatome) , les groupes alkyle, ester,
35 amide, amine, époxy et l'éthylèneglycol et les dérivés étant
préférés,, propyle, acétylène et C2 alcène étant spécialement95
préférés. Z peut aussi être un groupe sulfone, formant des
liaisons sulfonamide.
De cette manière, les ligands de fixation de capture
5 comprenant des protéines, lectines, acides nucléiques, petites
molécules organiques, hydrates de carbone, etc. peuvent être
ajoutés.
Un mode de- réalisation préféré utilise les ligands de fixation
10 de capture protéiques. Comme connu dan's la technique,
n'importe quel nombre de techniques peut être utilisés pour
lier un ligand de fixation de capture protéique à un lieur de
liaison. Une large variété de techniques sont connues pour
ajouter des groupes caractéristiques aux protéines.
15
Un mode de réalisation préféré utilise des acides nucléiques
en tant que ligands de fixation de capture. Alors que la
plupart des discussions suivantes se concentrent sur des
acides nucléiques, comme l'appréciera l'homme du métier,
20 plusieurs des techniques expliquées brièvement ci-dessous
s'appliquent aussi de la même manière à des systèmes d'acides
non nucléiques.
L'acide nucléique de sonde de capture est lié de manière
25 covalente à l'électrode, par l'intermédiaire d'un "lieur de
liaison", qui peut être soit un oligomère conducteur (requis
pour les systèmes de mécanisme 1) , soit un isolateur. Par
"lié de manière covalente" on entend ici que deux groupes
caractéristiques sont liés par au moins une liaison, y compris
30 les liaisons sigma, les liaisons pi et les liaisons de
coordination.
Ainsi, un bout du lieur de liaison est lié à un acide
nucléique (ou d'autres ligands de fixation) et l'autre bout
35 (bien que comme l'appréciera l'homme du métier, il n'est pas
nécessaire que ce soit 1'extrémité exacte pour 1 ' un comme pour
l'autre) est lié à l'électrode. Ainsi, n'importe quelle96
structure représentée ici peut ainsi effectivement comprendre
un acide nucléique comme groupe terminal. Ainsi, la présente
invention fournit des compositions comprenant des acides
nucléiques liés de manière covalente à des électrodes comme
5 généralement représenté ci-dessous dans la structure 17 :
/
/
STRUCTURE 17
-f,?(Xoui)?r,?acide nucléique
A
Dans la structure 17, les marques hachurées sur la gauche
10 représentent une électrode. X est un oligomère conducteur et I
est un isolateur comme décrit ici. Fi, est une liaison qui
permet la liaison covalente de l'électrode et de l'oligomère
conducteur de l'isolateur y compris les liaisons, atomes ou
lieurs tels que décrits ici, par exemple comme (A) défini ci-
15 dessous. F2 est une liaison qui permet l'attachement de
manière covalente de l'oligomère conducteur ou de l'isolateur
à l'acide nucléique, et peut être une liaison ou un atome
comme décrit ici. F2 peut être une partie de l'oligomère
conducteur, une partie de l'isolateur, une partie de l'acide
20 nucléique, ou exogène aux deux, par exemple, comme décrit ici
pour "Z".
Dans un mode de réalisation préféré, l'acide nucléique de
sonde de capture est lié de manière covalente à 1 ' électrode
25 par l'intermédiaire d'un oligomère conducteur. La liaison
covalente de l'acide nucléique et de l'oligomère conducteur
peut être accomplie de différentes manières. Dans un mode de
réalisation préféré, la liaison se fait par l'intermédiaire de
la liaison à la base du nucleoside, par l'intermédiaire de la
30 liaison au squelette de l'acide nucléique (soit le ribose soit
le phosphate, soit à un groupe analogue d'un squelette
analogue d'acide nucléique), soit par l'intermédiaire d'un
ligand de métal de transition, comme décrit ci-dessous. Les
techniques décrites brièvement ci-dessous sont généralement97
décrites pour les acides nucléiques naturels, bien que comme
l'appréciera l'homme du métier, les techniques similaires
peuvent être utilisées avec des analogues d'acide nucléique,
et dans certains cas avec d'autres ligands de fixation.
5
Dans un mode de réalisation préféré, l'oligomère conducteur
est lié à la base d'un nucleoside de l'acide nucléique. Ceci
peut être effectué de plusieurs manières, selon l'oligomère,
comme décrit ci-dessous. Dans un mode de réalisation,
10 l'oligomère est lié au nucleoside terminal, c'est-à-dire soit
le nucleoside 3' soit le nucleoside 5' de l'acide nucléique.
En variante, l'oligomère conducteur est lié à un nucleoside
interne.
15 Le point de liaison à la base va varier avec la base.
Généralement, la liaison est possible à n'importe quelle
position. Dans certains modes de réalisation, par exemple
quand la sonde contenant les ETM peut être utilisée pour
l'hybridation (c'est-à-dire des systèmes de mécanisme 1), on
20 préfère lier à des positions qui ne sont pas impliquées dans
la liaison de l'hydrogène à la base complémentaire. Ainsi, par
exemple, la liaison se fait généralement sur la position 5 ou
6 des pyrimidines comme 1'uridine, la cytosine et la thymine.
Pour les purines comme l'adénine et la guanine, la liaison se
25 fait préférablement par l'intermédiaire de la position 8. La
liaison à des bases non standard est de préférence effectuée à
des positions comparables.
Dans un mode de réalisation, la liaison est directe ; c'est-à-
30 dire qu'il n'y a pas d'atomes intervenant entre l'oligomère
conducteur et la base. Dans ce mode de réalisation, par
exemple, des oligomères conducteurs avec des liaisons
acétylène terminales sont liés directement à la base. La
structure 18 est un exemple de cette liaison, en utilisant un
35 oligomère conducteur de structure 3 et 1'uridine comme la
base, bien que d'autres bases et d'autres oligomères98
conducteurs puissent être utilisés comme l'appréciera l'homme
du métier :
Structure 18
o
Il doit être noté que les structures de pentose représentées
ici peuvent avoir des groupes hydrogène, hydroxy, phosphate ou
d'autres groupes en tant que groupes amino liés. En outre, les
structures de pentose et de nucleoside représentées ici sont
10 représentées de manière non conventionnelle, comme des images
en miroir de l'interprétation normale. En outre, les
structures de pentose et de nucleoside peuvent aussi contenir
des groupes additionnels, comme les groupes de protection, à
n'importe quelle position, par exemple si nécessaire au cours
15 de la synthèse.
En outre, la base peut contenir des modifications
additionnelles si nécessaire, c'est-à-dire que des groupes
carbonyle ou amine peuvent être altérés ou protégés.
20
Dans mode de réalisation en variante, la liaison peut être
n'importe quel nombre de différents lieurs Z, y compris des
liaisons amide et amine, comme généralement représentées dans
la structure 19 utilisant l'uridine comme la base et un
25 oligomère de structure 3 :99
STRUCTURE 19

Dans ce mode de réalisation, Z est un lieur. De préférence, Z
est un lie'ur court d'environ 1 à environ 10 atomes, de 1 à 5
5 atomes étant préféré, qui peut ou pas contenir des liaisons
alcène, alcynyle, amine, amide, azo, imine, etc. Les lieurs,
sont connus dans la technique ; par exemple les homo- ou
hétéro-lieurs bifonctionnels sont bien connus (voir le
catalogue 1994 Pierce Chemical Company, section technique sur
10 les lieurs croisés, pages 155 à 200) . Les lieurs Z préférés
comprennent, mais sans s'y limiter, des groupes alkyle (y
compris des groupes alkyle substitués et des groupes alkyle
contenant des groupes caractéristiques d'hétéroatome), les
groupes alkyle courts, les groupes ester, amide, amine, époxy
15 et l'éthylèneglycol et les dérivés étant préférés, le propyl,
l'acétylène, et C2 alcène étant spécialement préféré. Z peut
aussi être un groupe sulfone, formant des liaisons sulfamides
comme discuté ci-dessous.
20 Dans un mode de réalisation préféré, la liaison de l'acide
nucléique et de l'oligomère conducteur se fait par
l'intermédiaire de la liaison au squelette de l'acide
nucléique. Ceci peut être effectué d'un certain nombre de
manières, y compris la liaison à un ribose de squelette
25 ribose-phosphate, ou au phosphate du squelette, ou d'autres
groupes de squelettes analogues.
Avant tout, il doit être compris que le site de liaison dans
ce mode de réalisation peut être un nucleotide d'extrémité
30 3' ou 5' , ou à un nucleotide interne ; comme il est décrit de
manière plus précise ci-dessous.100
Dans un mode de réalisation, 1'oligomère conducteur est lié à
la ribose du squelette ribose-phosphate. Ceci peut être
effectué de plusieurs manières. Comme il est connu dans la
technique, les nucleotides qui sont modifiés par l'une ou
5 l'autre des positions 2' sur les positions 3' du ribose avec
des groupes amino, des groupes sulfure, des groupes silicone,
des groupes phosphore, ou des groupes oxo peuvent être
effectués (Imazawa et al. , J. Org. Chem., 44:2039 (1979);
Hobbs et al., J. Org. Chem. 42(4) :714 (1977); Verkeyden et
10 al. , J. Org. Chem. 36(2) :250 (1971) ; McGee et al. , J. Org.
Chem. 61:781-785 (1996); Mikhailopulo et al., Liebigs. Ann.
Chem. 513-519 (1993) ; McGee et al. Nucleosides & Nucleotides
14(6) :1329 (1995) . Ces nucleosides modifiés sont alors
utilisés pour ajouter des oligomères conducteurs.
15
Un mode de réalisation préféré utilise des nucleosides amino
modifiés. Ces riboses amino modifiés peuvent alors être
utilisés pour former soit des liaisons amide soit des liaisons
amine aux oligomères conducteurs. Dans un mode de réalisation
20 préféré, le groupe amino est lié directement au ribose, bien
que comme l'appréciera l'homme du métier, les lieurs courts
comme ceux décrits ici pour "Z" peuvent être présents entre le
groupe amino et le ribose.
25 Dans un mode de réalisation préféré, une liaison amide est
utilisée pour la liaison au ribose. De préférence, si
l'oligomère conducteur de structure 1-3 est utilisé, m est
zéro et alors 1'oligomère conducteur se termine dans la
liaison amide. Dans ce mode de réalisation, l'azote du groupe
30 amino du ribose amino modifié est l'atome "D" de l'oligomère
conducteur. Ainsi, une liaison préférée de ce mode de
réalisation est représentée dans la structure 20 (en utilisant
un oligomère conducteur de structure 3) :101
Structure 20
_^Y_B_^_Y_C_K
base
Comme l'appréciera l'homme du métier, la liaison terminale de
la structure 20 est fixée comme une liaison amide.
5
Dans mode de réalisation préféré, une liaison hétéroatome est
utilisée, c'est-à-dire oxo, amine, sulfure, etc. Un mode de
réalisation préféré utilise une liaison amine. De nouveau,
comme expliqué brièvement ci-dessus pour les liaisons amide,
10 pour les liaisons amine, l'azote du ribose amino modifié peut
être l'atome "D" de l'oligomère conducteur quand l'oligomère
conducteur de structure 3 est utilisé. Ainsi, par exemple, les
structures 21 et 22 représentent des nucleosides avec des
oligomères conducteurs de structure 3 et 9 respectivement,
15 utilisant l'azote comme 1'hétéroatome, bien que d'autres
hétéroatomes puissent être utilisés :
20
25
Structure 21
^-B~lßizh
base
Dans la structure 21, de préférence à la fois m et t ne sont
pas égaux à zéro. Un Z préféré ici est un groupe méthylène, ou
d'autres lieurs alkyle aliphatiques. Un, deux ou- trois
carbones à cette position sont particulièrement utiles pour
des raisons synthétiques.
Structure 22
ÙM'U
base
Dans la structure 22, Z est comme défini ci-dessus. Des lieurs
30 convenables comprennent du méthylène et de l'éthylène.102
Dans un mode de réalisation en variante, l'oligomère
conducteur est lié de manière covalente à l'acide nucléique
par l'intermédiaire du phosphate du squelette ribose-phosphate
(ou analogues) d'un acide nucléique. Dans ce mode de
5 réalisation, la liaison est directe, elle utilise un lieur ou
passe par une liaison amide. La structure 23 représente une
liaison directe et la structure 24 représente une liaison par
l'intermédiaire d'une liaison amide (les deux utilisent
l'oligomère conducteur de la structure 3, bien que les
10 oligomères conducteurs de la structure " 8 soient aussi
possibles). Les structures 23 et 24 représentent l'oligomère
conducteur dans la position 3', bien que la position 5' soit
aussi possible. De plus les structures 23 et 24 représentent
des liaisons phosphodiester naturelles, bien que comme
15 l'appréciera l'homme du métier, des analogues non standard de
liaisons phosphodiester peuvent aussi être utilisées.
Structure 23
20
25
^"?HK^T" ° ^ S
Dans la structure 23, si le Y terminal est présent (c'est-à-
dire m-l) alors de préférence Z n'est pas présent (c'est-à-
dire t=0). Si le Y terminal n'est pas présent, alors Z est de
préférence présent.
La structure 24 représente un mode de réalisation préféré,
dans lequel la liaison B-D terminale est une liaison amide, Y
terminal n'est pas présent, et le Z est un lieur, comme défini
ici.103
20
Structure 24
_£y--«--0J--y--«--M--1?..=0
Dans un mode de réalisation préféré, l'oligomère conducteur
est lié .de manière covalente à l'acide nucléique par
5 1'intermédiaire d'un ligand de métal de transition. Dans ce
mode de réalisation, l'oligomère conducteur est lié de manière
covalente à un ligand qui fournit un ou pus des atomes de
coordination pour un métal de transition. Dans un mode de
réalisation, le ligand auquel l'oligomère conducteur est lié
10 est aussi lié à l'acide nucléique, comme il est généralement
représenté ci-dessous dans la structure 25. En variante,
l'oligomère conducteur est lié à un ligand, et l'acide
nucléique est lié à un autre ligand, comme généralement
représenté ci-dessous dans la structure 26. Ainsi, en présence
15 du métal de transition, l'oligomère conducteur est lié de
manière covalente à l'acide nucléique. Ces deux structures
représentent des oligomères conducteurs de structure 3, bien
que d'autres oligomères puissent être utilisés. Les structures
25 et 26 représentent deux structures représentatives :
Structure 25
-f?B~ °)r£v:H2}?<
Acide nucléioue
L,
Structure 26
Acide nucléique
_^v_a_D\^Y^)_L
s
25 Dans les .structures représentées ici, M est un atome de métal,
les métaux de transition étant préférés. Les métaux de104
transition convenables pour l'utilisation dans la présente
invention comprennent, mais sans s'y limiter, le cadmium (Cd),
le cuivre (Cu) , le cobalt (Co) , le palladium (Pd) , le zinc
(Zn), le fer (Fe) , le ruthénium (Ru), le rhodium (Rh) ,
5 1'osmium (Oligomèresj, le rhénium (Re), le platine (Pt), le
scandium (Sc), le titane (Ti), le vanadium (V) , le chrome
(Cr), le manganèse (Mn), le nickel (Ni), le molybdène (Mo), le
technetium (Tc), le tungstène (W) et l'iridium (Ir). C'est-à-
dire, que- la première série de métaux de transition, les
10 métaux de platine (Ru, Rh, Pd, Os, Ir et Pt) , ainsi que Fe,
Re, W, Mo et Tc sont préférés. Sont particulièrement préférés
le ruthénium, le rhénium, l'osmium, le platine, le cobalt et
le fer.
15 L sont les co-ligands, qui fournissent les atomes de
coordination pour la situation de l'ion métallique. Comme
l'appréciera l'homme du métier, le nombre et la nature des co-
ligands va dépendre du nombre de coordination de l'ion
métallique. Les mono-, di- ou polydentate co-ligands peuvent
20 être utilisés à n'importe position. Ainsi, par exemple, quand
le métal a un nombre de coordination de six, le L de
l'extrémité de l'oligomère conducteur, le L en provenance de
l'acide nucléique, et r en ont ajouté jusqu'à six. Ainsi,
quand le métal a un nombre de coordination de six, r peut
25 aller de zéro (quand tous les atomes de coordination sont
fournis par les deux autres liaisons) à quatre, quand tous les
co-ligands' sont monodentés. Ainsi, généralement, r va être de
zéro à huit, selon le nombre de coordination de l'ion
métallique et le choix des autres liaisons.
30
Dans un mode de réalisation, l'ion métallique a un nombre de
coordination de six et l'ion lié à l'oligomère conducteur et
l'ion lié à l'acide nucléique sont au moins bidentés ; c'est-
à-dire que r est de préférence égal à zéro, un (c'est-à-dire
35 que le co-ligands restant est bidenté) ou deux (deux co-
ligands monodentés sont utilisés).105
Comme l'appréciera l'homme du métier, les co-ligands peuvent
être les mêmes ou différents. Les liaison convenables entrent
dans deux catégories : les ligands qui utilisent des atomes
d'azote, oxygène, soufre, carbone ou phosphate (tout dépend de
5 l'ion métallique) en tant qu'atome de coordination (en général
on y fait référence dans les oeuvres sous le terme donneur
sigma (o") ) et des liaison organométalliques comme les ligands
métallocènes (on y fait généralement référence . dans les
oeuvres sous le terme de donneur pi (tc) et représenté ici
10 comme Lm). Les ligands donneurs d'azote convenables sont bien
connus dans la technique et comprennent, mais sans s'y
limiter, NH2, NHR ; NRR ; pyridine ; pyrazine,
isonicotinamide ; imidazole ; bipyridine et les dérivés
substitués de bipyridine terpyridine et les dérivés
15 substitués ; phénanthroline, en particulier 1,10-
phénanthroline (abrégé phen) et dérivés substitués de
phénanthroline comme 4,7-diméthylphénanthroline et
dipyridol[3,2-a:2',3'-c]phénazine (en abrégé dppz) ;
dipyridophénazine ; 1,4, 5, 8, 9, 12-hexaazatriphénylène (abrégé
20 hat) ; 9,10-phénanthrénéquinone diimine (abrégé phi) ;
1,4,5,8-tétraazaphénanthrène (abrégé tap) ; 1,4,8,11-tétra-
azacyclotétradécane (abrégé cyclam), EDTA, EGTA et isocyanide.
Des dérivés substitués, y compris des dérivés soudés , peuvent
aussi être utilisés. Dans certains modes de réalisation, les
25 porphyrines et les dérivés substitués de la famille des
porphyrines peuvent être utilisés. Voir par exemple,
Comprehensive Coordination Chemistry, Ed. Wilkinson et al.,
Pergammon Press, 1987, chapitres 13-2 (pages 73 à 98) , 21.1
(pages 813 à 898) et 21.3 (pages 915 à 957).
30
Les liaisons donneurs sigma convenables utilisant du carbone,
de 1 'oxygène, du soufre et du phosphore sont connues dans la
technique. Par exemple, les donneurs de carbone sigma
convenables apparaissent dans Cotton and Wilkenson, Advanced
35 Organic Chemistry, 5éme Edition, John Wiley s Sons, 1988 ; voir
page 38. par exemple. De manière similaire, des ligands
d'oxygène convenables comprennent des éthers-couronne, de106
l'eau et d'autres connus dans la technique. Des phosphines et
des phosphines substituées sont aussi convenables ; voir page
38 de Cotton and Wilkenson.
5 Les ligands donneur's d'oxygène, soufre, phosphore et azote
sont liés de telle manière que les hétéroatomes peuvent servir
d'atomes de coordination.
Dans un ' mode de réalisation préféré, des liaisons
10 organométalliques sont utilisées. En plus des composés
purement organiques utilisés comme groupes caractéristiques
redox, et des différents complexes de coordination de métal de
transition avec un ligand organique Ô-lié avec des atomes
donneurs comme substituant hétérocyclique ou exocyclique, il
15 existe une large variété de composés organométalliques de
métal de transition disponibles avec des ligands organiques re-
liés (voir Advanced Inorganic Chemistry, 5ème édition, Cotton
and Wilkinson, John Wiley & Sons, 1988, chapitre 26 ;
Organometallics, A Concise Introduction, Elschenbroch et al.,
20 2ème Ed., 1992, VCH ; et Comprehensive Organometallic Chemistry
II, A Review of the Literature 1982-1994, Abel et al. Ed. Vol.
7, chapitres 7, 8, 10 & 11, Pergamon Press ) . De tels ligands
organométalliques comprennent des composés aromatiques
cycliques comme l'ion cyclopentadiénide [CsHsf-D] et divers
25 dérivés d'anneaux et dérivés soudés d'anneaux, comme 1 ' ion
indenylide (-1) qui produit une classe de composés
bis(cyclopentadieyl) métalliques, (c'est-à-dire les
métallocènes) ; voir par exemple Robins et al., J. Am. Chem.
Soc. 104:1882-1883(1982) ; et Gassman et al., J. Am. Chem.
30 Soc. 108:4228-4229 (1986). De ceci, le ferrocene de formule
[C5H5)2Fe] et ses dérivés sont des exemples prototypiques qui
ont été utilisés dans une grande variété de transfert
électrochimique (Connelly et al., Chem. Rev. 96:877-910(1996)
et électrochimique (Geiger et al., Advances in Organometallic
35 Chemistry 24:87) ou des réactions "redox". Les dérivés
métallocènes d'une variété de métaux de transition de
première, deuxième et troisième rangées sont des candidats107
potentiels en tant que groupes caractéristiques redox qui sont
liés de manière covalente soit à 1'anneau de ribose soit à la
base nucleoside de l'acide nucléique. D'autres liaisons
organométalliques potentiellement convenables comprennent les
5 arènes cycliques comme le benzène pour fournir des composés
bis(arène) métalliques et leurs dérivés substitués à 1'anneau
et soudés à 1'anneau, dont le bis(benzène)chrome est un
exemple prototypique. D'autres ligands acycliques rc-liés comme
1 ' ion allyl(-1) ou butadiene fournissent potentiellement des
10 composés organométalliques convenables, et tous ces mêmes
ligands conjointement avec d'autres ligands TC-iiés et ô-liés
constituent la classe générale des composés organométalliques
dans laquelle il y a un métal à liaison carbone. Des études
électrochimiques de différents dimères et oligomères de tels
15 composés avec des ligands organiques formant un pont, et des
ligands supplémentaires ne formant pas de pont, comme avec et
sans liaison métal-métal sont des groupes caractéristiques
redox de candidats potentiels dans l'analyse de l'acide
nucléique.
20
Quand un ou plusieurs des co-ligands est un ligand
organométallique, le ligand est généralement lié par
l'intermédiaire de l'un des atomes de carbone du ligand
organométallique, bien que la liaison puisse être par
25 1'intermédiaire d'autres atomes pour des ligands
hétérocycliques. Les ligands organométalliques préférés
comprennent les ligands de métallocène, y compris des dérivés
substitués et métallocélophanes (voir page 117 4 de Cotton et
Wilkenson, supra) . Par exemple des dérivés de ligands
30 métallocènes comme méthylcyclopentadiényle, la présence de
multiples groupes méthyle étant préférée, comme le
pentaméthylcyclopentadiényle, peuvent être utilisés pour
augmenter la stabilité du métallocène. Dans un mode de
réalisation préféré, un des deux ligands métallocènes d'un
35 métallocène est dérivé.108
10
15
Comme décrit ici, toute combinaison de ligands peut être
utilisée. Les combinaisons préférées comprennent : a) tous les
ligands comme les ligands donneurs d'azote ; b) tous les
ligands sont des ligands organométalliques ; et c) le ligand à
1'extrémité de T'oligomère conducteur est un ligand
métallocène et le ligand fourni par l'acide nucléique est un
ligand donneur d'azote, les autres ligands, si nécessaire sont
soit des ligands donneurs d'azote soit, des ligands de
métallocène, soit un mélange. Ces combinaisons sont
représentées dans des structures représentatives en utilisant
l'oligomère conducteur de la structure- 3 comme représenté dans
les structures 27 (utilisant phénanthroline et amino comme des
ligands représentatifs) , 28 (utilisant le ferrocene comme la
combinaison métal-ligand) et 29 (utilisant le
cyclopentadiényle et amino comme ligand représentatif).
Structure 27
-t?BK-^
20
Structure 28
,.......ife
Structure 29
-(-HtHft-®
base
25 Dans un mode de réalisation préféré, les ligands utilisés dans
l'invention montrent des propriétés fluorescentes altérées
selon l'état redox de l'ion métallique chelate. Comme décrit109
ci-dessous, celui-ci sert alors de mode supplémentaire de
détection du transfert d'électrons entre l'ETM et l'électrode.
De plus, des procédés similaires peuvent être utilisés pour
5 lier des protéines' à l'électrode de détection ; voir par
exemple le brevet U.S. N° 5 620 850, incorporé ici à titre de
référence.
Dans un mode de réalisation préféré, comme décrit de manière
10 plus précise ci-dessous, le ligand lié à l'acide nucléique est
un groupe amino lié à la positions 2' ou 3' d'un ribose d'un
squelette ribose-phosphate. Ce ligand peut contenir une
multiplicité de groupes amino de manière à former un ligand
polydenté qui fixe l'ion métallique. D'autres ligands préférés
15 comprennent le cyclopentadiène et phénanthroline.
L'utilisation d'ions métalliques pour connecter les acides
nucléiques peut servir de contrôle interne ou de calibration
du système, pour évaluer le nombre d'acides nucléiques
20 disponibles à la surface. Cependant, comme l'appréciera
l'homme du métier, si des ions métalliques sont utilisés pour
connecter les acides nucléiques aux oligomères conducteurs, il
est généralement souhaitable que ce complexe ionique
métallique soit un potentiel redox différent de celui des ETM
25 utilisées dans le reste du système comme décrit ci-dessous.
Ceci est généralement vrai de manière à être capable de
distinguer la présence de la sonde de capture de la présence
de la séquence cible. Ceci peut être utile pour
1'indentification, la calibration et/ou la quantification.
30 Ainsi, la quantité de sondes de capture sur une électrode peut
être comparée à la quantité d'acides nucléiques double brin
hybrides pour quantifier la quantité de séquences cibles dans
un échantillon. Ceci est assez significatif pour servir de
contrôle interne du capteur ou du système. Ceci permet une
35 mesure soit avant l'ajout de la cible soit après, sur les
mêmes molécules qui vont être utilisées pour la détection,
plutôt que de reposer sur un système de contrôle similaireno
mais différent. Ainsi, les molécules réelles qui vont être
utilisées pour la détection peuvent être quantifiées avant
tout expérience. Ceci est un avantage significatif sur les
méthodes antérieures.
5
Dans un mode de réalisation préféré, les acides nucléiques de
sondes de capture (ou d'autres ligands de fixation) sont liés
de manière covalente à l'électrode par l'intermédiaire d'un
isolateur.' La liaison des acides nucléiques (et d'autres
10 ligands de fixation) à des isolateurs comme des groupes alkyle
est bien connue, elle peut être effectuée sur la base ou le
squelette, y compris le ribose ou le phosphate pour des
squelette contenant ces groupes caractéristiques, ou sur des
squelettes alternes pour des analogues d'acides nucléiques.
15
Dans un mode de réalisation préféré, il peut y avoir une ou
plusieurs espèces de sondes de capture différentes sur la
surface. Dans certains modes de réalisation, il peut y avoir
un type de sonde de capture ou un succédané de sondes de
20 capture, comme il est décrit de manière plus précise ci-
dessous. En variante, différentes sondes de capture, ou une
sonde de capture avec une multiplicité de sondes succédanées
de capture différentes peuvent être utilisées. De manière
similaire, il peut être souhaitable (en particulier dans le
25 cas des analytes cibles et des ligands de fixation dans les
systèmes de mécanisme 2) d'utiliser des sondes de capture
auxiliaires qui comprennent des séquences de sondes
relativement courtes, qui peuvent être utilisées pour faire
"tomber" les composants du système, par exemple les lieurs de
30 recrutement, pour augmenter la concentration des ETM à la
surface.
Ainsi, la présente invention fournit des substrats comprenant
au moins une électrode de détection comprenant des couches
35 monomoléculaires et des ligands de fixation de capture, utiles
dans les -systèmes de détection des analytes cibles.Ill
Du mode de réalisation préféré, les compositions comprennent
de plus un ligand de fixation soluble ou de solution, bien que
comme il est décrit plus en détail ci-des sous, pour les
systèmes de mécanisme 1, les ETM peuvent être ajoutées sur la
5 forme d'indicateurs d'hybridation liés de manière non
covalente. Les ligands de fixation de solution sont similaires
aux ligands de fixation de capture, du fait qu'ils se fixent,
de préférence spécifiquement, aux analytes cibles. Le ligand
de fixation de solution peut être le même ou différent du
10 ligand de fixation de capture. De manière générale, les
ligands de fixation de solution ne sont pas directement liés à
la surface, bien que comme décrit sur la figure 5A, ils
puissent l'être. Le ligand de fixation de solution comprend
soit directement un lieur de recrutement qui comprend au moins
15 une ETM (figure 4A) , ou le lieur de recrutement se fixe, soit
directement (figure 4A) soit indirectement (figure 4E) , au
ligand.de fixation de solution.
Ainsi, "les ligands de fixation de solution" ou les "ligands
20 de fixation solubles" ou "les transporteurs de signaux" ou
"les sondes de marquage" ou "les ligands de fixation de
marquage" avec les lieurs de recrutement comprenant des ETM
liées de manière covalente sont fournis.
25 C'est-à-dire qu'une partie de la sonde de marquage ou du
ligand de fixation de solution se fixe directement ou
indirectement à l'analyte cible, et une partie comprend un
lieur de recrutement comprenant des ETM liées de manière
covalente. Dans certains systèmes, par exemple dans les
30 systèmes d'acides nucléiques du mécanisme 1, ils peuvent être
les mêmes. De manière similaire, pour les systèmes de
mécanisme 1, le lieur de recrutement comprend un acide
nucléique qui va s'hybrider aux sondes de détection. Les
termes "groupes caractéristiques donneurs d'électrons",
35 "groupes caractéristiques accepteurs d'électrons" et "ETM" où
des équivalents grammaticaux se réfèrent ici à des molécules
capables de transférer des électrons sur certaines conditions.112
Il doit être compris que les capacités de donneurs d'électrons
et d'accepteurs d* électrons sont relatives ; c'est-à-dire
qu'une molécule qui peut être un électron sous certains
conditions expérimentales va être capable d'accepter un
5 électrode sous différentes conditions expérimentales. Il doit
être compris que le nombre de groupes caractéristiques de
donneurs possibles et de groupes caractéristiques d'accepteurs
d'électrons possibles est très large, et que l'homme du métier
va être capable d'utiliser un certain nombre de composés dans
10 la présente invention. Les ETM préférées "comprennent, mais
sans s'y limiter, des complexes de métal de transition, des
ETM organiques, et des électrodes.
Dans un mode de réalisation préféré, les ETM sont des
15 complexes de métal de transition. Les métaux de transition
sont ceux dont les atomes ont une enveloppe d complète
d' électrons.
Les métaux de transition convenables pour utilisation dans
20 l'invention sont listés ci-dessous. Les métaux de transition
sont complexés à une variété de ligands, L, définis ci-
dessous, pour former les complexes de métal de transition
convenables, comme il est connu dans la technique.
25 En plus des complexes de métal de transition, d'autres
donneurs et accepteurs d'électrons organiques peuvent être
liés de manière covalente à l'acide nucléique pour
1'utilisation dans 1'invention. Ces molécules organiques
comprennent, mais sans s'y limiter, riboflavine, colorants
30 xanthène, colorants azine, acridine orange, dichlorure N,N'-
diméthyl-2,7-diazapyrénium(DAP2") , méthylviologène, bromure
d'éthidium, des quinones comme du dichlorure de N,N'
diméthylanthra(2,1, 9-def.6,5,10-d'e'f')diisoquinoline
(ADIQ2+) ; des porphyrines([meso-tetrakis(N-méthyl-x-
35 pyridinium)tétrachlorure de phorphyrine], du chlorydrate de
variamine blue B, du verre de Beindschedler ; 2,6-
dichloroindophénol, 2,6-dibromophénolindophénol ; du bleu de113
crête brillant (chlorure de (3-amino-9-diméthyl-amino-10-
méthylphénoxyazine) , du bleu de méthylène ; bleu du Nil A
(sulfate d'aminoaphthodiéthylaminophénoxazine), indigo-
5,5',7,7'-acide tétrasulfonique, indigo-5,5'7?acide
5 trisulfonique ; £>hénosafranine, indigo-5-acide mono-
sulfonique ; safranine T ; chlorure de bis
(diméthylglyoximato)-fer(II) ; induline écarlate, rouge
neutre, anthracene, coronène, pyrène, 9-phénylanthracène,
rubrène, ' binaphthyl, DPA, phénothiazène, fluoranthène,
10 phénanthrène, chrysène, 1, 8-diphényl-1,3,5,7-octatétracène,
naphtalène, acénaphtalène, pérylène, ? TMPD et analogues et
dérivés substitués de ces composés.
Dans un mode de réalisation, les donneurs et les accepteurs
15 d'électrons sont des protéines redox comme connues dans la
technique. Cependant, les protéines redox dans de nombreux
modes de réalisation ne sont pas préférées.
Dans un mode de réalisation, particulièrement quand on utilise
20 une étape d'électrophorèse, les ETM sont choisies pour être
des molécules chargées, de préférence quand l'analyte cible
n'est pas chargée. Ainsi, par exemple, les ligands de fixation
de solution qui contiennent soit directement soit
indirectement un nombre d'ETM chargées peuvent être liées à
25 l'analyte cible avant I'électrophorèse, pour permettre à
l'analyte cible d'avoir une charge suffisante pour se déplacer
dans le champ électrique, fournissant un but double de
fournisseurs de charges et de groupes caractéristiques de
détection. Ainsi, par exemple, des sondes de marquage qui
30 contiennent des ETM chargées peuvent être utilisées, qui se
fixent soit directement à l'analyte cible soit à une espèce
intermédiaire comme une sonde d'amplification peuvent être
utilisées. En variante, d'autres espèces chargées peuvent être
ajoutées en plus des ETM. En variante, ces espèces de charges
35 peuvent aussi être une partie intégrale du système ; par
exemple une partie de la sonde de marquage peut être un
polymère chargé comme la polylysine. Cependant, dans ce mode114
10
de réalisation, la migration des sondes de marquage fixées non
spécifiquement à la surface de détection peut résulter en
augmentation de signaux non spécifiques. Par conséquent, dans
ce mode de réalisation, l'utilisateur d'un champ électrique
inversé (généralement une impulsion de polarité inverse) après
I'électrophorèse peut résulter dans le fait que les sondes de
marquage fixées non spécifiquement soient entraînées hors ou
loin de la surface de la sonde de détection, pour réduire le
signal non' spécifique en arrière plan.
Le choix des ETM spécifiques peut être influencé par le type
de détection de transfert électronique utilisé, comme il est
expliqué brièvement de manière générale ci-dessous. Des ETM
préférées sont les métallocènes, le ferrocene, y compris les
15 dérivés, étant particulièrement préférés.
Dans un mode de réalisation préféré, une pluralité d'ETM a été
utilisée. Comme montré dans les exemples, l'utilisation d'ETM
multiples fournit une amplification de signal et permet ainsi
20 des limites de détection plus sensibles. Comme discuté ci-
dessous, alors que l'utilisation d'ETM multiples sur des
acides nucléiques qui hybrident des brins complémentaires peut
causer des baisses en Tms des complexes d'hybridation selon le
nombre, le site de la liaison et l'espacement entre les ETM
25 multiples, ce n'est pas un facteur quand les ETM sont sur le
lieur de recrutement (c'est-à-dire des systèmes de "mécanisme
2") puisque celui-ci ne s'hybride pas à une séquence
complémentaire. En conséquence, des pluralité d'ETM sont
préférées, avec au moins environ 2 ETM par lieur de
30 recrutement étant préférées, et au moins environ 10 étant
particulièrement préférées, et au moins entre 20 et 50 étant
spécialement préférées. Dans certains exemples, de très gros
nombres d'ETM (50 à 1000) peuvent être utilisés.
35 Ainsi, des ligands de fixation de solution, ou des sondes de
marquage, avec des ETM liés de manière covalente sont fournis.
Le procédé de liaison de l'ETM au ligand de fixation de115
10
solution peut varier selon le mode de détection (c'est-à-dire
les systèmes de mécanisme 1 ou 2) et la composition du ligand
de fixation de la solution. Comme il est expliqué plus en
détail ci-dessous, dans les systèmes de mécanisme 2, la partie
de ligand de fixation de solution (ou de sonde de marquage)
qui comprend l'ETM est nommé "lieur de recrutement" et peut
comprendre soit des acides nucléiques soient des acides non
nucléiques. Pour les systèmes de mécanisme 1, le lieur de
recrutement peut être un acide nucléique.
Ainsi, comme l'appréciera l'homme du métier, il existe une
variété de configuration qui peuvent être utilisées. Dans un
mode de réalisation préféré, le lieur de recrutement est un
acide nucléique (y compris analogues), et la liaison des ETM
15 peut se faire par l'intermédiaire de (1) une base ; (2) du
squelette, y compris le ribose, le phosphate, ou des
structures comparables dans les analogues d'acides
nucléiques ; (3) d'un remplacement de nucleosides, décrit ci-
dessous ; ou (4) des polymères de métallocène, comme décrit
20 ci-dessous. Dans un mode de réalisation préféré, le lieur de
recrutement est un acide non nucléique, et il peut être soit
un polymère de métallocène soit un polymère de type alkyle (y
compris hétéroalkyle, comme il est décrit de manière plus
précise ci-dessous) contenant des groupes de substitution
25 d'ETM. Ces options sont généralement représentées sur la
figure 7.
Dans un mode de réalisation préféré, le lieur de recrutement
et un acide nucléique, et comprend des ETM liés de manière
30 covalente. Les ETM peuvent être liés à des nucleosides au sein
de l'acide nucléique dans une variété de positions. Les modes
de réalisation préférés comprennent, mais sans s'y limiter,
(1) une liaison à la base du nucleoside (2) une liaison de
l'ETM comme un remplacement de base, (3) une liaison à un
35 squelette de l'acide nucléique, y compris soit un ribose du
squelette ribose-phosphate soit un groupe caractéristique de
phosphate, ou à des structures analogues dans des analogues116
d'acides nucléiques, et (4) une liaison par l'intermédiaire
des polymères métallocènes.
En outre, comme décrit ci-dessous, quand le lieur de
5 recrutement est un 'acide nucléique, il peut être souhaitable
d'utiliser des sondes de marquage secondaires, qui ont une
première partie qui va s'hybrider à une partie de la première
sonde de marquage et une seconde partie comprenant un lieur de
"recrutement comme défini ici. Ceci est généralement représenté
10 sur la figure 6Q et 6R ; ceci est similaire à l'utilisation
d'une sonde d'amplification, à l'exception du fait que tant la
sonde primaire que la sonde de marquage secondaire comprennent
des ETM.
15 Dans un mode de réalisation préféré, l'ETM est liée à la base
d'un nucleotide comme expliqué généralement ci-dessous pour la
liaison d'un oligomère conducteur. La liaison peut être à un
nucleoside interne ou un nucleoside terminal.
20 La liaison covalente à la base va dépendre en partie de l'ETM
choisie, mais en général est similaire à la liaison
d'oligomères conducteurs à des bases, comme expliqué
brièvement ci-dessus. La liaison peut généralement être
effectuée à n'importe quelle position de la base. Dans un mode
25 de réalisation préféré, 1'ETM est un complexe de métal de
transition, et ainsi la liaison d'un ligand de métal
convenable à la base guide à la liaison covalente de l'ETM. En
variante, des types similaires de liaisons peuvent être
utilisés pour la liaison des ETM organiques, comme
30 1'appréciera 1'homme du métier.
Dans un mode de réalisation, le groupe amino lié en C4 de
cytosine, le groupe amino lié en C6 de l'adénine ou le groupe
amino lié en C2 de la guanine peut être utilisé comme un
35 ligand de métal de transition.117
Les groupes aromatiques contenant des ligands peuvent être
liés par l'intermédiaire des liaisons acétylène comme connu
dans la technique (voir Comprehensive Organic Synthesis, Trost
et al., Ed., Pergamon Press, Chapter 2.4:Coupling Reactions
5 Between sp2 et support Carbon Centers, Sonogashira, pages 521
à 54 9, et pages 950 à 953) . La structure 30 représente une
structure représentative en présence d'un ion métallique et
tous autres ligands nécessaires ; la structure 30 représente
1'uridine,' bien que pour toutes les structures ici, toute
10 autre base peut aussi être utilisé.
Structure 30
o
La est un ligand, qui peut comprendre des ligands donneurs
15 d'azote, d'oxygène, de soufre, ou de phosphore ou des ligands
organométalliques comme des ligands de métallocène. Des
ligands La convenables comprennent, mais sans s'y limiter, la
phénanthroline, l'imidazole, bpy et terpy. La et M sont comme
définit ci-dessous. A nouveau, l'homme du métier appréciera,
20 un lieur ("Z") peut être inclut entre le nucleoside et l'ETM.
De manière similaire, comme pour les oligomères conducteurs,
la liaison peut être effectuée en utilisant un lieur, qui peut
utiliser une liaison amide (voir généralement Telser et al.,
25 J. Am. Chem. Soc. 111:7221-7226 (1989) ; Telser et al., J. Am.
Chem. Soc. 111:722 6-7232 (198 9) . Ces structures sont
généralement représentées ci-dessous dans la structure 31, qui
utilise à nouveau 1'uridine comme la base, bien que comme ci-
dessus, les autres bases peuvent aussi être utilisées.
30118
Structure 31
o
Dans ce mode de réalisation,. L est -un- ligand- comme défini ci-
dessous, avec La et M comme définis de même ci-dessous. De
5 préférence, L est amino, phen, byp et terpy.
Dans un mode de réalisation préféré, l'ETM lié à un nucleoside
est un métallocène ; c'est-à-dire que le L et La de la
structure 31 sont tous les deux des ligands métallocène, Lm
10 est comme décrit ci-dessous. La structure 32 représente un
mode de réalisation préféré dans lequel le métallocène est
ferrocene, et la base est uridine, bien que d'autres bases
puissent être utilisées :
15
20
Structure 32
o
Des données préliminaires suggèrent que la structure 32 puisse
faire un cycle, le second atome de carbone acétylène attaquant
l'oxygène carbonyle, formant une structure comme le furanne.
Les métallocènes préférés comprennent le ferrocene, le
cobaltocène et 1'osmiumocène.
Dans un mode de réalisation préféré, l'ETM est lié à un ribose
à n'importe quelle position du squelette ribose-phosphate de
25 1'acide nucléique, c'est-à-dire soit l'extrémité 5' ou 3' soit
un nucleoside interne quel qu'il soit. Le ribose dans ce cas
peut comprendre des analogues de ribose. Comme il est connu119
dans la technique, des nucleosides qui sont modifiés sur la
position soit 2' soit 3' du ribose peuvent être effectués, des
notifications contenant de l'azote, de l'oxygène, du soufre et
du phosphore étant possibles. Le ribose amino modifié et
5 oxygène modifié est'préféré. Voir généralement la publication
PCT du document WO 95/15971. Ces groupes de modification
peuvent être utilisés comme ligand de métal de transition, ou
comme un groupe fonctionnel chimiquement pour la liaison
d'autres ligands de métal de transition et d'autres ligands
10 organométalliques, ou des groupes caractéristiques de donneurs
d'électrons organiques comme l'appréciera l'homme du métier.
Dans ce mode de réalisation, un lieur comme décrit ici pour
"Z" peut être aussi utilisé, ou un oligomère conducteur entre
le ribose et 1'ETM. Des modes de réalisation préférés
15 utilisent la liaison sur les positions 2' ou 3' du ribose, la
position 2' étant préférée. Ainsi, par exemple, les oligomères
conducteurs représentés dans la structure 13, 14 et 14 peuvent
être remplacés par des ETM ; en variante, les ETM peuvent être
ajoutées à l'extrémité libre de l'oligomère conducteur.
20
Dans un mode de réalisation préféré, un métallocène sert comme
paire d'ETM, et il est lié par 1 ' intermédiaire d'une liaison
amide comme décrit ci-dessous dans la structure 33. Les
exemples expliquent brièvement la synthèse d'un composé
25 préféré quand le métallocène est ferrocene.
Structure 33
Dans un mode de réalisation préféré, des liaisons amine sont
30 utilisées, comme généralement représenté dans la structure 34.120
Structure 34
BASE
Z est un lieur, comme défini ici, de 1-16 atomes étant
préférés, et 2-4 atomes étant particulièrement préférés, et t
5 est soit un soit zéro.
Dans un mode de réalisation préféré, les liaisons oxo sont
utilisées, comme généralement représenté dans la structure 35.
10 Structure 35
BASE
Dans la structure 35, Z est un lieur, comme défini ici, et t
est soit un soit zéro. Les lieurs Z préférés comprennent des
15 groupes alkyle y compris des groupes hétéroalkyle comme (CH2) n
et (CH2CH20)n, n de 1 à 10 étant préféré, et n =- 1 à 4 étant
spécialement préféré, et n = 4 étant particulièrement préféré.
Les liaisons utilisant d'autres hétéroatomes sont aussi
20 possibles.
Dans un mode de réalisation préféré, une ETM est lié à un
phosphate à n'importe quelle position du squelette ribose
phosphate de l'acide nucléique. Ceci peut être effectué d'une
25 variété de moyens différents. Dans un mode de réalisation, les
analogues de liaisons phosphodiester comme les liaisons
phosphoramidé ou phosphoramidite peuvent être incorporées dans
un acide nucléique, où 1'hétéroatome (c'est-à-dire l'azote)121
sert de ligand de métal de transition (voir publication PCT du
document WO 95/15971). En variante, les oligomères conducteurs
représentés sur les figures 23 et 24 peuvent être remplacés
par des ETM. Dans un mode de réalisation préféré, la
5 composition a la structure montrée dans la structure 36.
Structure 36
a*ss
O---(2)i---ETM
\
Dans la structure 36, l'ETM est liée par l'intermédiaire d'une
10 liaison phosphate, généralement au travers de l'utilisation
d'un lieur, Z. les lieurs Z préférés comprennent des groupes
alkyle, y compris des groupes hétéroalkyle comme {Crl2) nr
(CH2CH20)n/ avec n de 1 à 10 étant préféré, et n = 1 à 4 étant
spécialement préféré et n = 4 étant particulièrement préféré.
15
Dans des systèmes de mécanisme-2, quand l'ETM est liée à la
base ou au squelette du nucleoside, il est possible de lier
l'ETM par l'intermédiaire des structures "dendrimères", comme
il est expliqué de manière plus précise ci-dessous. Comme il
20 est généralement représenté sur la figure 8, les lieurs basés
alkyle peuvent être utilisés pour créer des structures de
ramification multiples comprenant une ou plusieurs ETM à
l'extrémité de chaque ramification. De manière générale, ceci
est effectué en créant des points de ramification contenant
25 des groupes hydroxy multiples, qui peuvent facultativement
être utilisés pour ajouter des points de ramification
supplémentaires. Des groupes hydroxy terminaux peuvent être
alors utilisés dans les réactions de phosphoramidite pour
ajouter des ETM, comme généralement effectué ci-dessous pour
30 le remplacement de nucleosides et les réactions de polymère de
métallocènes.122
Dans un mode de réalisation préféré, une ETM telle qu'un
métallocène est utilisée comme "remplacement de nucleoside",
servant comme ETM. Par exemple, la distance entre les deux
anneaux cyclopentadiène de ferrocene est similaire à la
5 distance orthogonale entre deux bases dans un acide nucléique
double brin. D'autres métallocènes en plus du ferrocene
peuvent être utilisés, par exemple, des métallocènes stables
dans l'air comme ceux contenant du cobalt ou du ruthénium.
Ainsi, les groupes caractéristiques métallocènes peuvent être
10 incorporés dans le squelette d'un acide nucléique, comme
généralement représenté dans la structure 37 (acide nucléique
avec un squelette ribose-phosphate) et structure 38 (squelette
d'acide nucléique peptidique). Les structures 37 et 38
représentent du ferrocene, bien que comme l'appréciera l'homme
15 du métier, d'autres métallocènes peuvent être aussi utilisés.
En général, les métallocènes stables dans l'air sont préférés,
y compris les métallocènes utilisant du ruthénium et du cobalt
comme métal.
20 Structure 37
BASE
~^ô
u U
Dans la structure 37, Z est un lieur comme défini ci-dessous,
les groupes alkyle courts y compris des hétéroatomes comme
l'oxygène étant généralement 'préférés. Généralement, ce qui
25 est important est la longueur du lieur, de manière à ce qu'il
y ait des perturbations minimes de l'acide nucléique double123
10
brin, comme décrit de manière plus précise ci-dessous. Ainsi,
méthylène, ethylene, éthylèneglycol, propylene et butylène
sont tous préférés, l'éthylène et l'éthylèneglycol étant
particulièrement préférés. En outre, chaque lieur Z peut être
le même ou différent; la structure 37 représente un squelette
ribose-phosphate, bien que comme l'appréciera l'homme du
métier, des analogues d'acide nucléique peuvent aussi être
utilisés, y compris des analogues de ribose et des analogues
de liaisons phosphate.
Structure 38
V
?XN
<
MN----2---
<rO
o
11
.C «ASÉ
<~
HM
\
Dans la structure 38, des groupes Z préférés sont comme listés
ci-dessous, et à nouveau, chaque lieur Z peut être le même ou
15 différent. Comme ci-dessus, d'autres analogues d'acides
nucléiques peuvent aussi être utilisés.
En outre, bien que les structures et la discussion ci-dessus
représentent des métallocènes, et particulièrement du
20 ferrocene, cette même idée générale peut être utilisée pour
ajouter des ETM au métallocène, comme remplacement de
nucleosides ou dans des modes de réalisation polymères,
décrits ci-dessous. Ainsi, par exemple, quand l'ETM est un
complexe de métal de transition autre que le métallocène,
25 comprenant un, deux ou trois ligands (ou plus), les ligands
peuvent être fonctionnalisés comme représentés pour le
ferrocene pour permettre l'ajout de groupes phosphoramidite.124
Sont particulièrement préférés dans ce mode de réalisation les
complexes comprenant au moins deux ligands d'anneaux (par
exemple, aryle et aryle substitué), où chacun des ligands
comprend des groupes fonctionnels pour la liaison par
5 l'intermédiaire de' la chimie phosphoramidite. Comme
l'appréciera l'homme du métier, ce type de réaction, créant
des polymères d'ETM soit comme partie du squelette de l'acide
nucléique soit comme "groupes latéraux" des acides nucléiques,
pour permettent l'amplification des signaux générés ici, peut
10 être effectuée avec pratiquement n'importe quelle ETM qui peut
être fonctionnalisée pour contenir les groupes chimiques
corrects.
Ainsi, en insérant un métallocène comme un ferrocene (ou
15 autres ETM) dans le squelette de l'acide nucléique, les
analogues d'acides nucléiques sont effectués ; c'est-à-dire
que l'invention fournit des acides nucléiques ayant un
squelette comprenant au moins un métallocène. Ceci se
distingue des acides nucléiques ayant des métallocènes liés au
20 squelette, c'est-à-dire par l'intermédiaire d'un ribose, un
phosphate, etc. c'est-à-dire que deux acides nucléiques,
chacun composé d'un acide nucléique traditionnel ou analogues
(des acides nucléiques dans ce cas y compris un nucleoside
simple), peuvent être liés de manière covalente 1 ' un à 1'autre
25 par l'intermédiaire d'un métallocène. Vu sous un autre angle,
un dérivé métallocène ou un métallocène substitué est fourni,
dans lequel chacun des deux anneaux aromatiques du métallocène
a un groupe substituant d'acide nucléique.
30 En outre, comme il est expliqué plus précisément ci-dessous,
il est possible d'incorporer plus d'un métallocène dans le
squelette, soit avec des nucleosides entre les deux et/ou avec
des métallocènes adjacents. Quand les métallocènes adjacents
sont ajoutés au squelette, cela se rapproche du processus
35 décrit ci-dessous comme "polymères métallocènes" ; c'est-à-
dire qu'il existe des zones de polymères mécaniques à
l'intérieur du squelette.125
En plus des groupes de substitution d'acides nucléiques, il
est aussi souhaitable dans certains exemples d'avoir des
groupes de substitution supplémentaires pour l'un ou les deux
5 anneaux aromatiques' du métallocène (ou ETM). Par exemple,
comme ces remplacements de nucleosides font généralement
partie de séquences de sondes à hybrider avec un acide
nucléique sensiblement complémentaire, par exemple une
séquence cible ou une autre séquence de sonde, il est possible
10 d'ajouter les groupes substituants aux anneaux de métallocène
pour faciliter la succession de l'hydrogène à la base ou aux
bases sur le brin opposé. Ceux-ci peuvent être ajoutés à
n'importe quelle position sur les anneaux métallocènes. Des
groupes substituants convenables comprennent, mais sans s'y
15 limiter, des groupes amide, des groupes amine, des acides
carboxyliques, et des alcools, y compris des alcools
substitués. En outre, ces groupes de substitution peuvent être
liés aussi par l'intermédiaire des lieurs, bien qu'en général
ça ne soit pas préféré.
20
En outre, des groupes substituant sur une ETM, en particulier
des métallocènes comme le ferrocene, peuvent être ajoutés pour
altérer les propriétés redox de l'ETM. Ainsi, par exemple,
dans certains modes de réalisation, comme il est décrit plus
25 précisément ci-dessous, il peut être souhaitable d'avoir
différentes ETM liées de différentes manières (c'est-à-dire
liaison de base ou de ribose) sur différentes sondes, ou pour
différents buts (par exemple, calibration ou en tant que
standard interne). Ainsi, l'ajout de groupes substituants sur
30 le métallocène peut permettre à deux ETM différentes d'être
distinguées.
En vue de générer ces analogues d'acides nucléiques à
squelette métallocène, les composants intermédiaires sont
35 aussi fournis. Ainsi, dans un mode de réalisation préféré,
l'invention fournit des métallocènes phosphoramidite, comme
représenté généralement dans la structure 39 :126
Structure 39
PG---0
[ ANNEAU
2_____ARCJMAT1 QUE
? ANNEAU
AROMATIQUE
NCHjCH-^C---P---?--CH^CH3
I \
CH CHa
H3C CH3
Dans la structure 39, PG est un groupe de protection,
généralement convenable pour l'utilisation dans la synthèse de
5 1'acide nucléique, DMT, MMT et TMT étant tous préférés. Les
anneaux aromatiques peuvent aussi être les anneaux du
métallocène, ou des anneaux aromatiques de ligands pour des
complexes de métal de transition ou d'autres ETM organiques.
Les anneaux aromatiques peuvent être les mêmes ou différents
10 et peuvent être substitués comme discuté ici. La structure 4 0
représente le dérivé de ferrocene.
NCH2CH_C
15 Ces analogues phosphoramidite peuvent être ajoutés à des
synthèses oligonucleotides standard comme il est connu dans la
technique.127
10
15
La structure 41 représente le monomère d'acide nucléique
peptide ferrocene (PNA), qui peut être ajouté à la synthèse de
PNA comme il est connu dans la technique :
Structure 41
PG---NH
Fe
©
Z
/
o=c
OH
Dans la structure 41, le groupe de protection PG est
convenable pour l'utilisation dans la synthèse de l'acide
nucléique peptidique, MMT, boc et Fmoc étant préférés.
Les mêmes composés intermédiaires peuvent être utilisés pour
former les polymères ETM ou métallocènes, qui sont ajoutés aux
acides nucléiques, plutôt que comme remplacements de squelette
comme il est décrit de manière plus précise ci-dessous.
Dans un mode de réalisation préféré, en particulier pour
l'utilisation des systèmes de mécanisme 2, les ETM sont liées
comme des polymères, par exemple comme des polymères
métallocènes, dans une configuration "ramifiée" similaire au
20 mode de réalisation "ADN ramifié" ici et comme expliqué
brièvement dans le brevet U.S N° 5 124 246 utilisant des
nucleotides fonctionnalisés modifiés. L'idée générale est
comme suit. Un nucleotide phosphoramidite modifié est généré
qui peut contenir en fin de compte un groupe hydroxy libre qui
25 peut être utilisé dans la liaison des ETM phosphoramidite
comme les métallocènes. Ce groupe hydroxy libre peut être sur
la base ou le squelette, comme le ribose ou le phosphate (bien
que comme l'appréciera l'homme du métier, des analogues
d'acides nucléiques comprenant d'autres structures peuvent
30 aussi être utilisés). Le nucleotide modifié est incorporé à un
acide nucléique, et tout groupe de protection hydroxy est
déplacé, laissant ainsi l'hydroxy libre. En ce qui concerne128
l'ajout d'ETM phosphoramidite comme un métallocène, comme
décrit ci-dessus dans les structures 39 et 40, des ETM, comme
des ETM métallocènes, sont ajoutées. Des ETM phosphoramidite
supplémentaires comme des métallocènes peuvent être ajoutées,
5 pour former des "p'olymères ETM", y compris "des polymères
métallocènes" comme décrit sur la figure 9 avec le ferrocene.
En outre, dans certains modes de réalisation, il est
souhaitable d'augmenter la solubilité des polymères en
ajoutant Un groupe "de coiffage" à l'ETM terminale dans le
10 polymère, par exemple un groupe phosphate final au métallocène
comme généralement représenté sur la figure 9. D'autres
groupes de "coiffage" améliorant la solubilité convenable
peuvent être appréciés par l'homme du métier. Il doit être
noté que ces groupes d'amélioration de solubilité peuvent être
15 ajoutés aux polymères à d'autres endroits, y compris aux
anneaux de ligands, par exemple sur les métallocènes comme
discuté.
Un mode de réalisation préféré de cette idée générale est
20 expliqué brièvement sur les figures. Dans ce mode de
réalisation, la position 2' d'un ribose d'un nucleotide
phosphoramidite est tout d'abord fonctionnalisée pour contenir
un groupe hydroxy protégé, dans ce cas par l'intermédiaire
d'une liaison oxo, bien que n'importe quel nombre de lieurs
25 peut être utilisé, comme généralement décrit ici pour les
lieurs Z. Le nucleotide modifié protégé est alors incorporé
par l'intermédiaire d'une chimie phosphoramidite standard dans
un acide nucléique en croissance. Le groupe de protection est
enlevé, et le groupe hydroxy libre est utilisé, utilisant à
30. nouveau la chimie phosphoramidite standard pour ajouter un
métallocène phosphoramidite comme un ferrocene. Une réaction
similaire est possible pour des analogues d'acides nucléiques.
Par exemple, en utilisant des acides nucléiques peptidiques et
le monomère métallocène montré dans la structure 41, les
35 structures d'acides nucléiques peptidiques contenant des
polymères métallocènes peuvent être générées.129
Ainsi, la présente invention fournit des lieurs de recrutement
d'acides nucléiques comprenant "des ramifications" de
polymères métallocènes comme généralement représentés sur les
figures 8 et 9. Les modes de réalisation préférés utilisent
5 aussi des polymè fes métallocènes de 1 à environ 50
métallocènes en longueur, d'environ 5 à environ 20 étant
préféré et d'environ 5 à environ 10 étant spécialement
préféré.
10 En outre, quand le lieur de recrutement est un acide
nucléique, une combinaison des liaisons ETM peut être
effectuée. En général, comme expliqué brièvement ici, quand
des systèmes de mécanisme 1 sont utilisés, des groupes de
nucleosides contenant des ETM peuvent baisser le Tm
15 d'hybridation de la sonde à sa séquence cible ; ainsi, en
général, pour des systèmes de mécanisme 1, les ETM sont
espacées le long de la séquence, où seuls de petits nombres
sont utilisés.
20 Dans des systèmes de mécanisme-1, des ETM liées de manière non
covalente peuvent être utilisées. Dans un mode de réalisation,
l'ETM est un indicateur d'hybridation. Les indicateurs
d'hybridation ont un rôle lorsqu'une ETM qui va s'associer de
préférence avec un acide nucléique double brin est ajoutée,
25 habituellement de manière réversible, de façon similaire au
procédé de Millan et al., Anal. Chem. 65:2317-2323(1993) ;
Millan et al., Anal. Chem. 662943-2948 (1994). Dans ce mode de
réalisation, les augmentations de la concentration locale
d'ETM, dues à l'association de l'indicateur d'hybridation
30 d'ETM avec un acide nucléique double brin à la surface,
peuvent être surveillées en utilisant les couches
monomoléculaires comprenant les oligomères conducteurs. Les
indicateurs d'hybridation comprennent des intercalaires et des
groupes caractéristiques de fixation de sillons majeurs et/ou
35 mineurs. Dans un mode de réalisation préféré, les
intercalaires peuvent être utilisées ; étant donné que
1'intercalage se produit généralement uniquement en présence130
de 1 ' acide nucléique double brin, les ETM ne vont se
concentrer qu'en présence d'acide nucléique double brin. Les
ETM complexes du métal de transition d'intercalage sont
connues dans la technique. De même, des groupes
5 caractéristiques de'fixation de sillons majeures ou mineures,
comme le bleu de méthylène, peuvent aussi être utilisés dans
ce mode de réalisation.
De plus, ' les systèmes d'accélération de fixation de
10 l'invention peuvent être utilisés dans pratiquement n'importe
quel procédé qui repose sur la détection électrochimique des
analytes cibles, avec une utilité particulière dans la
détection d'acides nucléiques. Par exemple, les procédés et
compositions de l'invention peuvent être utilisés dans les
15 procédés de détection d'acides nucléiques qui reposent sur la
détection d'ETM qui sont inhérentes à l'analyte cible. Par
exemple, comme décrit généralement dans Napier et al.,
Bioconj. Chem. 8:90 6 (1997), les bases de guanine de l'acide
nucléique peuvent être détectées par l'intermédiaire des
20 changements dans l'état redox, c'est-à-dire l'oxydation de
guanine par des complexes ruthénium. De manière similaire, les
procédés de l'invention trouvent une utilité dans les systèmes
de détection qui utilisent des surfaces de cuivre comme
électrodes catalytiques pour oxyder les riboses des acides
25 nucléiques.
Dans un mode de réalisation préféré, le lieur de recrutement
n'est pas un acide nucléique, et peut être à la fois tout type
de lieur ou de polymère. Comme l'appréciera l'homme du métier,
30 en général tout lieur ou polymère qui peut être modifié pour
contenir des ETM peut être utilisé. En général, les polymères
ou les lieurs doivent être raisonnablement solubles et
contenir des groupes fonctionnels convenables pour l'addition
d'ETM.
35
Comme utilisé ici, un "polymère de recrutement" comprend au
moins deux ou trois sous-unités, qui sont liées de manière131
covalente. Au moins certaines parties des sous-unités
monomeriques contiennent des groupes fonctionnels pour la
liaison covalente des ETM. Dans certains modes de réalisation,
des groupes caractéristiques de couplage sont utilisés pour
5 lier de manière covalente les sous-unités avec les ETM. Des
groupes fonctionnels préférés pour la liaison sont les groupes
amino, les groupes carboxy, les groupes oxo et les groupes
thiol, les groupes amino étant particulièrement préférés.
Comme l'appréciera l'homme du métier, une large variété de
10 polymères de recrutement est possible.
Les lieurs convenables comprennent, mais sans s'y limiter, les
lieurs alkyle (y compris hétéroalkyle (y compris des
structures de type (poly)éthylèneglycol), alkyle substitué,
15 des lieurs arylalkyle, etc. Comme ci-dessus pour les
polymères, les lieurs peuvent comprendre un ou plusieurs
groupes fonctionnels pour la liaison des ETM, qui va être
effectuée comme l'appréciera l'homme du métier, par exemple au
travers de l'utilisation d'homo- ou hétéro-lieurs
20 bifonctionnels comme il est bien connu (voir le catalogue 1994
Pierce Chemical Company, section technique sur les lieurs
croisés, pages 155 à 200).
Les polymères de recrutement convenables comprennent mais sans
25 s'y limiter, des styrènes fonctionnalisés, comme amino
styrène, des dextranes fonctionnalisés, et des acides
polyamines. Des polymères préférés sont les acides nucléiques
polyamines (à la fois des acides nucléiques polyaminés-D et
des acides polyaminés-L) comme la polylysine, et les polymères
30 contenant la lysine et d'autres acides aminés étant
particulièrement préférés. Comme expliqué brièvement ci-
dessus, dans certains modes de réalisation, les lieurs de
recrutement chargés sont préférés, par exemple quand des
analytes cibles non chargés doivent être détectées. D'autres
35 acides polyamines convenables sont l'acide polyglutamique,
l'acide polyaspartique, les copolymères de lysine et l'acide
glutamique ou aspartique, les copolymères de lysine avec132
alanine, tyrosine, phenylalanine, serine, tryptophane et/ou
proline.
Dans un mode de réalisation préféré, le lieur de recrutement
5 comprend un polymère' de métallocène, comme décrit ci-dessus.
La liaison des lieurs de recrutement à la première partie de
la sonde de marquage, c'est-à-dire la partie qui se fixe soit
directement soit indirectement à 1'analyte cible, va dépendre
10 de la composition du lieur de recrutement, comme l'appréciera
l'homme du métier. Quand le lieur de recrutement est un acide
nucléique, il est généralement formé au cours de la synthèse
de la première partie de la sonde de marquage, avec
incorporation des nucleosides contenant des ETM si nécessaire.
15 En variante, la première partie de la sonde de marquage et du
lieur de recrutement peut être effectuée séparément, puis
liée. Par exemple, il peut y avoir une section superposable de
complémentarité, formant une section d'acide nucléique double
brin qui peut alors être chimiquement liée transversalement,
20 par exemple en utilisant du psoralène comme connu dans la
technique.
Quand les lieurs de recrutement d'acide non nucléique sont
utilisés, la liaison du lieur/polymère du lieur de recrutement
25 va être effectuée généralement en utilisant des techniques
chimiques standard, comme 1'appréciera 1'homme du métier. Par
exemple, quand des lieurs basés alkyle sont utilisés, la
liaison peut être similaire à la liaison des isolateurs à
acide nucléique.
30
En outre, il est possible d'avoir des lieurs de recrutement
qui sont des mélanges d'acide nucléique et d'acide non
nucléique, soit sous une forme linéaire (c'est-à-dire les
segments d'acide nucléique liés à des lieurs alkyle) ou des
35 formes ramifiées (acides nucléiques avec des "ramifications"
alkyle qui peuvent contenir des ETM et peuvent être ramifiées
traditionnellement).133
Dans un mode de réalisation particulier, par exemple quand
l'analyte cible est un acide nucléique, c'est la séquence
cible elle-même qui transporte les ETM, plutôt que le lieur de
5 recrutement d'une sonde de marquage. Par exemple, comme décrit
de manière plus précise ci-dessous, il est possible d'ajouter
*
enzymatiquement des nucleotides triphosphate comprenant les
ETM de l'invention à un acide nucléique en croissance, par
exemple au cours de la chaîne de réaction de la polymerase
10 (PCR). Comme le reconnaîtra l'homme du métier, alors qu'on a
montré que de nombreux enzymes tolèrent généralement des
nucleotides modifiés, certains des nucleotides modifiés de
l'invention, par exemple les modes de réalisation "de
remplacement de nucleosides" et de manière généralement admise
15 certaines des liaisons phosphate, peuvent ou ne peuvent pas
être reconnues par les enzymes pour permettre l'incorporation
à un acide nucléique en croissance. Par conséquent, les
liaisons préférées dans ce mode de réalisation se trouvent à
la base ou au ribose du nucleotide.
20
Ainsi, par exemple, l'amplification PCR de la séquence cible,
comme il est connu dans la technique, va avoir pour résultat
des séquences cibles comprenant des ETM, généralement
incorporées au hasard dans la séquence. Le système de
25 l'invention peut alors être configuré pour permettre la
détection en utilisant ces ETM, comme généralement représenté
sur les figures 6A et 6B.
En variante, comme expliqué plus en détail ci-dessous, il est
30 possible d'ajouter enzymatiquement des nucleotides comprenant
des ETM à l'extrémité d'un acide nucléique, par exemple un
acide nucléique cible. Dans ce mode de réalisation, un "lieur
de recrutement" efficace est ajouté à l'extrémité de la
séquence cible, qui peut alors être utilisé pour la détection,
35 comme généralement représenté sur la figure 6Q. Ainsi,
l'invention fournit des compositions utilisant des électrodes
comprenant des couches monomoléculaire d'oligomères134
conducteurs et de sondes de capture, et des séquences cibles
qui comprennent une première partie qui est capable de
s'hybrider à un composant du complexe de dosage, et une
seconde partie qui ne s'hybride pas au composant du complexe
5 de dosage et comprend au moins un groupe caractéristique de
transfert d'électrons lié de manière covalente. De manière
similaire, des procédés utilisant ces compositions sont aussi
fournis.
10 II est aussi possible d'avoir des ETM connectées aux séquences
sondes, c'est-à-dire des séquences conçues pour qu'elles
s'hybrident aux séquences complémentaires, c'est-à-dire dans
les séquences de mécanisme 1, bien que cela puisse aussi être
utilisé dans les systèmes de mécanisme 2. Ainsi, les ETM
15 peuvent aussi être ajoutées aux lieurs de non recrutement. Par
exemple, il peut y avoir des ETM ajoutées à des sections de
sondes de marquage qui ne s'hybrident pas aux composants du
complexe de dosage, par exemple la première partie, ou à la
séquence cible comme expliqué brièvement ci-dessus et
20 représentée sur la figure 6R. Ces ETM peuvent être utilisées
pour la détection de transfert d'électrons dans certains modes
de réalisation, ou ils peuvent ne pas l'être, selon la
localisation et les systèmes. Par exemple, dans certains modes
de réalisation, quand par exemple la séquence cible contenant
25 des ETM incorporées au hasard est hybridée directement à la
sonde de capture, comme décrit sur la figure 6A et la figure
6B, il peut y avoir des ETM dans la partie s'hybridant à la
sonde de capture. Si la sonde de capture est liée à
l'électrode utilisant un oligomère conducteur, ces ETM peuvent
30 être utilisées pour détecter le transfert d'électrons comme il
a été décrit au préalable. En variante, ces ETM peuvent ne pas
être détectées spécifiquement.
De manière similaire, dans certains modes de réalisation,
35 quand le lieur de recrutement est un acide nucléique, il peut
être souhaitable dans certains exemples que certains ou tous
les lieurs de recrutement soient à double brin, par exemple135
dans les systèmes de mécanisme 2. Dans un mode de réalisation,
il peut exister un section lieur de recrutement, sensiblement
complémentaire au premier lieur de recrutement, qui peut
s'hybrider au premier lieur de recrutement. Dans un mode de
5 réalisation préféré,' le premier lieur de recrutement comprend
les ETM liées de manière covalente. Dans un autre mode de
réalisation, le second lieur de recrutement contient les ETM,
et les ETM sont recrutées à la surface par . hybridation du
second lieur de recrutement au premier. Dans encore un autre
10 mode de réalisation, tant le premier que le second lieurs de
recrutement comprennent des ETM. Il- doit être noté, comme
discuté ci-dessus, que les acides nucléiques comprenant un
grand nombre d'ETM peuvent aussi ne pas s'hybrider, c'est-à-
dire que le Tm peut être réduit, tout dépend du site de
15 liaison et des caractéristiques de l'ETM. Ainsi, en général,
quand des ETM multiples sont utilisés sur des brins hybridant,
c'est-à-dire dans les systèmes de mécanisme 1, il y en a
généralement moins d'environ 5, moins d'environ 3 étant
préférés, ou alternativement les ETM peuvent être suffisamment
20 espacées les unes des autres pour que les nucleotides
intervenants puissent s'hybrider suffisamment pour permettre
une bonne cinétique.
Dans un mode de réalisation préféré, les compositions de
25 l'invention sont utilisées pour détecter des analytes cibles
dans un échantillon. Dans un mode de réalisation préféré,
l'analyte cible est un acide nucléique, et les séquences
cibles sont détectées. Le terme "séquence cible" ou
équivalents grammaticaux signifie ici une séquence d'acides
30 nucléiques sur un brin simple d'acide nucléique. La séquence
cible peut être une partie d'un gène, une séquence
régulatoire, un ADN génomique, un ADN c, un ARN y compris des
ARN m et ARN r ou d'autres. Elle peut être de n'importe quelle
taille, sachant que les séquences plus longues sont plus
35 spécifiques. Comme l'appréciera l'homme du métier, la séquence
cible complémentaire peut prendre plusieurs formes. Par
exemple, elle peut être contenue dans une séquence d'acide136
nucléique plus grosse, c'est-à-dire tout ou partie d'un gène
ou ARNm, un fragment de restriction d'un ADN plasmidique ou
génomique, entre autre. Comme il est expliqué plus précisément
ci-dessous, on créé des sondes pour qu'elles s'hybrident aux
5 séquences cibles pour déterminer la présence ou l'absence de
séquences cibles dans un échantillon. De manière générale, ce
terme peut être compris par l'homme du métier. La séquence
cible peut aussi être composée de différents domaines cibles ;
par exemple, un premier domaine de la séquence cible
10 échantillon peut s'hybrider à une sonde de capture ou une
partie de sonde succédanée de capture, un second domaine cible
peut s'hybrider à une portion d'une sonde d'amplification,
d'une sonde de marquage ou une sonde de capture différente ou
d'une sonde succédanée de capture,etc. Les domaines cibles
15 peuvent être adjacents ou séparés. Les termes "premier" et
"second" n'ont pas pour signification de conférer une
orientation des séquences par rapport à l'orientation 5'-3' de
la séquence cible. Par exemple, en considérant une orientation
5'-3' de la séquence cible complémentaire, le premier domaine
20 cible peut être localisé en 5' au second domaine, ou en 3' du
second domaine.
Si nécessaire, l'analyte cible est préparée en utilisant des
techniques connues. Par exemple, l'échantillon peut être
25 traité pour lyser les cellules, en utilisant des tampons de
lyse connus, l'électroporation, etc., avec purification et/ou
amplification comme l'amplification PCR si nécessaire, comme
l'appréciera l'homme du métier.
30 Pour des systèmes d'acide nucléique, les sondes de la présente
invention sont conçues pour être complémentaires à une
séquence cible, (soit la séquence cible de l'échantillon soit
à d'autres séquences sondes, comme décrit ci-dessous), de
manière à ce que l'hybridation de la séquence cible et des
35 sondes de la présente invention ait lieu. Comme expliqué
brièvement ci-dessous, il n'est pas nécessaire que cette
complémentarité soit parfaite ; il peut y avoir n'importe quel137
nombre de mésappariements de paires de base qui va interférer
avec 1'hybridation entre la séquence cible et les acides
nucléiques simple brin de la présente invention. Cependant, si
le nombre de mutation est trop important pour que
5 1 ' hybridation puiss'e avoir lieu même dans les conditions
d'hybridation les moins rigoureuses, la séquence n'est pas une
*
séquence cible complémentaire. Ainsi, par "sensiblement
complémentaire" on entend ici que les sondes sont suffisamment
complémentaires aux séquences cibles pour s'hybrider dans des
10 conditions de réactions normales.
Généralement, les compositions d'acide nucléique de
1'invention sont utiles comme sonde oligonucleotide. Comme
l'appréciera l'homme du métier, la longueur de la sonde peut
15 varier avec la longueur de la séquence cible et de
l'hybridation et les conditions de nettoyage. En général, les
sondes d'oligonucléotides vont d'environ 8 à environ 50
nucleotides, à environ 10 à environ 30 étant préféré et
d'environ 12 à environ 25 étant spécialement préféré. Dans
20 certains cas, de très longues sondes peuvent être utilisées,
par exemple de 50 à 200-300 nucleotides. Ainsi, dans les
structures représentées ici, des nucleosides peuvent être
remplacés par des acides nucléiques.
25 Une variété de conditions d'hybridation peuvent être utilisés
dans la présente invention, y compris des conditions très
rigoureuses, moyennement rigoureuses, et peu rigoureuses ;
voir par exemple Maniatis et al., Molecular Cloning : A
Laboratory Manual, 2d Edition, 1989, et Short Protocols in
30 Molecular Biology, ed. Ausubel, et al., incorporés ici à titre
de référence. Les conditions rigoureuses dépendent des
séquences et seront différentes dans des circonstances
différentes. Des séquences plus longues s'hybrident
spécifiquement à des températures supérieures. On peut trouver
35 un guide complet de 1'hybridation des acides nucléiques dans
Tijssen, ? Techniques in Biochemistry and Molecular Biology-
Hybridization with Nucleic Acid Probes, "Overwiew of138
principles of hybridization and the strategy of nuclei acid
assays" (1993). En général, des conditions rigoureuses sont
d'environ 5 à 10 °C inférieures au point de fusion thermique
(Tm) pour la séquence spécifique à un pH de force ionique
5 défini. Le Tm est là température (à une force ionique, un pH,
et une concentration en acide nucléique définies) à laquelle
50 % des sondes complémentaires à la cible s'hybrident à la
séquence cible à l'équilibre (comme les séquences cibles sont
présentes 'en excès, à Tm, 50 % des sondes sont occupées à
10 l'équilibre). Des conditions rigoureuses vont être celles
auxquelles la concentration de sel est inférieure à environ
1,0 ions sodium, typiquement à une concentration d'ions sodium
d'environ 0,01 à 1,0 M (ou d'autres sels) à pH 7,0 à 8,3 et la
température est au moins d'environ 30 °C pour les sondes
15 courtes (par exemple 10 à 50 nucleotides) et au moins
d'environ 60 °C pour les sondes longues (par exemple
supérieure à 50 nucleotides). Les conditions rigoureuses
peuvent aussi être atteintes avec l'addition d'agents
déstabilisants comme le formamide.
20
Dans un autre mode de réalisation, des conditions
d'hybridation moins rigoureuses sont utilisées, par exemple,
des conditions moyennement ou faiblement rigoureuses peuvent
être utilisées, comme connu dans la technique ; voir Maniatis
25 et Ausubel, supra, et Tijssen, supra.
Les conditions d'hybridation peuvent aussi varier quand un
squelette non ionique, c'est-à-dire que des polynucléaires
aromatiques sont utilisés, comme connu dans la technique. En
30 outre, des agents réticulants peuvent aussi être ajoutés après
la fixation de la cible pour une liaison transversale, c'est-
à-dire lier de manière covalente les deux brins du complexe
d'hybridation.
35 Comme l'appréciera l'homme du métier, les systèmes de
1'invention peuvent prendre un nombre important de
configurations différentes, comme généralement représenté sur139
les figures 3, 4, 5 et 6. En général, il existe trois types de
systèmes qui peuvent être utilisés : (1) les systèmes dans
lesquels la séquence cible elle-même est marquée avec des ETM
(voir figure 4A, 5A, -5B et 5D ; ceci est généralement utile
5 pour les systèmes d"acide nucléique) ; (2) les systèmes dans
lesquels les sondes de marquage se fixent directement aux
analytes cibles (voir les figures 4C et 4H pour des exemples
d'acides nucléiques et les figures 6A, 6B, 6D et 6E pour des
exemples d'acides non nucléiques) ; et (3) des systèmes dans
10 lesquels les sondes de marquage sont indirectement fixées aux
séquences cibles, par exemple au travers de l'utilisation de
sondes d'amplification (voir les figures 4C, 5E, 5F et 5G pour
les exemples d'acides nucléiques et la figure 6C pour des
analytes cibles d'acide non nucléique représentatifs.)
15
Dans chacun des ces trois systèmes, il est aussi préféré, bien
que non requis, que la séquence cible soit immobilisée à la
surface de l'électrode. Ceci est effectué de préférence en
utilisant des sondes de capture et facultativement une ou plus
20 sondes succédanées de capture ; voir figure 3 pour des
exemples d'acides nucléiques représentatifs. Quand seules des
sondes de capture sont utilisées, il est nécessaire d'avoir
des sondes uniques pour chaque séquence cible ; c'est-à-dire
que la surface doit être personnalisée pour contenir des
25 sondes de capture uniques. En variante, des sondes succédanées
de capture peuvent être utilisées, qui permettent une surface
"universelle", c'est-à-dire une surface contenant un seul type
de sonde de capture qui peut être utilisé pour détecter
n'importe quelle séquence cible. Les sondes "succédanées de
30 capture" sont généralement représentées sur les figures 4C,
5C, 5E et 5H, comme sur la figure 6B, etc., et ont une
première partie qui s'hybride à tout ou partie de la sonde de
capture, et une seconde partie qui s'hybride à une partie de
la séquence cible. Ceci permet alors la génération de sondes
35 solubles personnalisées, qui comme l'appréciera l'homme du
métier sont en général plus simples et moins onéreuses. Comme
montré ici, deux sondes de capture succédanées peuvent être140
utilisées. Ceci a en général été effectué pour stabiliser des
complexes de dosage (par exemple quand la séquence cible est
grosse, ou quand de grosses sondes d'amplification (des sondes
d'amplification dendrimères ou ramifiées) sont utilisées.
5
Alors que la discussion et les figures représentent
généralement ici des modes de réalisation d'acide nucléique,
ces mêmes idées peuvent être utilisées pour des^ analytes
cibles d'acides nucléiques. Par exemple, des ligands
10 succédanés de capture peuvent être générés, comme l'appréciera
l'homme du métier. Par exemple, une "queue" d'acide nucléique
peut être utilisée pour un ligand de fixation, comme
généralement représenté sur la figure 6B.
15 Dans un mode de réalisation préféré, les ligands de fixation
sont ajoutés après la formation de la SAM ((4) ci-dessus).
Ceci peut être effectué selon une variété de moyens
différents, comme l'appréciera l'homme du métier. Dans un mode
de réalisation, des oligomères conducteurs avec des groupes
20 fonctionnels terminaux sont effectués, des modes de
réalisation préférés utilisant des carboxylates et des
isothiocyanates activés, qui vont réagir avec des amines
primaires qui sont soit présentes soit placées sur le ligand
de fixation comme un acide nucléique, en utilisant un
25 carboxylate activé. Ces deux réactifs ont l'avantage d'être
stables en solution aqueuse, et réagissent pourtant avec des
alkylamines primaires. Cependant, les amines aromatiques
primaires et les amines secondaires et tertiaires des bases ne
doivent pas réagir, permettant ainsi l'addition spécifique de
30 sites d'acides nucléiques à la surface. Ces techniques
similaires peuvent être utilisées avec des composants d'acide
non nucléique ; par exemple, comme expliqué ci-dessus, la
liaison de protéines au SAM comprenant des chelates
métalliques est connue ; voir brevet U.S. N° 5 620 850. Ceci
35 permet l'observation des sondes (des sondes de détection ou de
capture, .ou les deux) en utilisant des procédés connus (jet
d'encre, spotting, etc.) à la surface.141
En outre, il existe un certain nombre de procédés d'acides
nucléiques qui peuvent être utilisés pour immobiliser un acide
nucléique à une surface. Par exemple, des paires partenaires
5 de fixation peuvent être utilisées ; c'est-à-dire un
partenaire de fixation est lié à l'extrémité de l'oligomère
conducteur, et l'autre à la fin de l'acide nucléique. Ceci
peut être effectué aussi en utilisant une sonde de capture
d'acide "nucléique ; c'est-à-dire qu'un partenaire de fixation
10 sert de sonde de capture et que l'autre e"st lié soit à la
séquence cible soit à la sonde succédanée de capture. C'est-à-
dire que, soit la séquence cible comprend le partenaire de
fixation, soit la sonde succédanée de capture qui va hybrider
la séquence cible comprend le partenaire de fixation. Des
15 paires de partenaires de fixation convenables comprennent,
mais sans s'y limiter, des paires haptène comme la
biotine/streptavidine ; des antigènes/anticorps ; l'acide
nitrilotriacétique/marqueurs histidine ; etc. En général, des
partenaires de fixation plus petits sont préférés, de manière
20 à ce que les électrons puissent passer de l'acide nucléique à
l'oligomère conducteur pour permettre la détection.
Dans un mode de réalisation préféré, quand la séquence cible
elle-même est modifiée pour contenir un partenaire de
25 fixation, le partenaire de fixation est lié par
l'intermédiaire d'un nucleotide modifié qui peut être lié
enzymatiquement à la' séquence cible, par exemple au cours de
l'étape d'amplification de la cible PCR. En variante, le
partenaire de fixation doit être facilement lié à la séquence
30 cible.
En variante, une sonde succédanée de capture peut être
utilisée qui a une partie d'acide nucléique pour l'hybridation
à la cible tout comme un partenaire de fixation (par exemple,
35 la sonde succédanée de capture peut comprendre une partie
d'acide non nucléique comme un lieur alkyle qui est utilisé
pour se lier aux partenaires de fixation) . Dans ce mode de142
réalisation, il peut être souhaitable de croiser l'acide
nucléique double brin de la cible et la sonde succédanée de
capture pour la stabilité, par exemple en utilisant du
Psoralene comme connu dans la technique.
5
Dans un mode de réalisation, la cible n ' est pas fixée à la
surface de l'électrode en utilisant des sondes de capture.
Dans ce mode de réalisation, ce qui est important, comme pour
tous les dosages ici, c'est que les sondes de marquage en
10 excès soient enlevées avant la détection et que le complexe de
dosage (le lieur de recrutement) soit à proximité de la
surface. Comme 1'appréciera 1'homme du métier, ceci peut être
accompli par des moyens différents. Par exemple, le complexe
de dosage peut être présent sur les billes qui sont ajoutées à
15 1'électrode comprenant la couche monomoléculaire. Les lieurs
de recrutement comprenant les ETM peuvent être placés à
proximité de la surface de l'oligomère conducteur en utilisant
des techniques bien connues dans la technique, y compris en
réglant la gravité des billes à la surface, des interactions
20 magnético électrostatiques entre les composants des billes et
la surface, en utilisant une liaison du partenaire de fixation
comme expliqué ci-dessus. En variante, après avoir enlevé les
réactifs en excès comme les sondes de marquage en excès, le
complexe de dosage peut être abaissé vers la surface, par
25 exemple par électrophorèse comme expliqué ici.
Cependant, des modes de réalisation préférés utilisent des
complexes de dosage liés par sonde de capture d'acide
nucléique.
30
Dans un mode de réalisation préféré, la séquence cible elle-
même contient les ETM. Comme discuté ci-dessus, ceci peut être
effectué en utilisant des séquences cibles qui ont des ETM
incorporées à n'importe quel nombre de positions, comme
35 expliqué ci-dessus. Dans ce mode de réalisation, comme pour
les autres du système, 1'orientation 3'-5' des sondes et
cibles est choisie pour avoir les structures contenant des ETM143
(c'est-à-dire les lieurs de recrutement ou les séquences
cibles) aussi proches de la surface de la couche
monomoléculaire que possible, et à une orientation correcte.
Ceci peut être effectué en utilisant la liaison par
5 l'intermédiaire des ' isolateurs ou des oligomères conducteurs
comme généralement montré sur les figures. En outre, comme
l'appréciera l'homme du métier, des sondes de capture
multiples peuvent être utilisées, soit dans une configuration
comme représentée sur la figure 5D, dans laquelle
10 l'orientation 5'?3 ' des sondes de capture est différente, soit
là où la forme de la cible a des "boucles" quand des sondes de
capture multiples sont utilisées.
Dans un mode de réalisation préféré, les sondes de marquage
15 s'hybrident directement aux séquences cibles, comme
généralement représenté sur les figures. Dans ces modes de
réalisation, la séquence cible est de préférence, mais n'est
pas nécessaire qu'elle le soit, immobilisée à la surface en
utilisant des sondes de capture, y compris des sondes
20 succédanées de capture. Les sondes de marquage sont alors
utilisées pour entraîner les ETM à proximité de la surface de
la couche monomoléculaire comprenant des oligomères
conducteurs. Dans un mode de réalisation préféré, des sondes
de marquage multiples sont utilisées ; c'est-à-dire, que des
25 sondes de marquage sont conçues de manière à ce que la partie
qui s'hybride à la séquence cible puisse être différente pour
un certain nombre de sondes de marquage différentes, de
manière à ce que l'amplification du signal ait lieu, puisque
des sondes de marquage multiples peuvent se fixer pour chaque
30 séquence cible. Ainsi, comme décrit sur les figures, n est un
nombre entier relatif au moins égal à un. Selon la sensibilité
souhaitée, la longueur de la séquence cible, le nombre d'ETM
par sonde de marquage, etc., les gammes préférées de n vont de
1 à 50, d'environ 1 à environ 20 étant particulièrement
35 préférées et d'environ 2 à environ 5 étant spécialement
préférées. En outre, si des sondes de marquage "génériques"
sont souhaitées, des sondes succédanées de marquage peuvent144
être utilisées comme généralement décrit ci-dessous pour
l'utilisation avec des sondes d'amplification.
Comme ci-dessus, en général dans ce mode de réalisation la
5 configuration du système et les sondes de marquage sont
conçues pour recruter les ETM aussi près que possible de la
*
surface de la couche monomoléculaire.
Dans un mode de réalisation préféré, les sondes de marquage
10 sont hybridées indirectement à la séquence cible. C'est-à-dire
que la présente invention trouve une utilité dans les
nouvelles combinaisons de technologies d'amplification de
signal et de détection de transfert d'électrons sur les
électrodes, qui peuvent être particulièrement utiles dans les
15 dosages d'hybridation intercalés, comme représenté
généralement sur les figures pour les modes de réalisation
d'acide nucléique ; les systèmes similaires peuvent être
développés pour les analytes cibles d'acide non nucléique.
Dans ces modes de réalisation, les sondes d'amplification de
20 l'invention sont fixées à la séquence cible dans un
échantillon soit directement soit indirectement. Comme les
sondes d'amplification contiennent de préférence un nombre
relativement important de séquences cibles qui sont
disponibles pour la fixation de sondes de marquage, le signal
25 détectable est augmenté de manière significative, et permet
aux limites de détection de la cible d'être améliorées de
manière significative. Ces sondes de marquage et
d'amplification, et les procédés de détection décrits ici,
peuvent être essentiellement utilisés dans n'importe quel
30 format d'hybridation d'acide nucléique connu, comme ceux dans
lesquels la cible est fixée directement à une phase solide ou
à des dosages d'hybridation intercalés dans lesquels la cible
est fixée à un ou plusieurs acides nucléiques qui sont fixés à
tour de rôle à la phase solide.
35
En général, ces modes de réalisation peuvent être décrits
comme suit avec une référence particulière aux acides145
nucléiques. Une sonde d'amplification est hybridée à la
séquence cible, soit directement (par exemple figures 4C et
5E), ou par 1'utilisation d'une sonde succédanée de marquage
(par exemple figure 5F et 5G) , qui sert à permettre aux sondes
5 d'amplification (génériques) d'être effectuées. La séquence
cible est de préférence, mais il n'est pas nécessaire qu'elle
le soit, immobilisée sur l'électrode utilisant des sondes de
capture. De préférence, la sonde d'amplification contient une
multiplicité de séquences d'amplification, bien que dans
10 certains modes de réalisation, comme décrit ci-dessous, la
sonde d'amplification peut seulement contenir une seule
séquence d'amplification. La sonde d'amplification peut
prendre un certain nombre de formes différentes ; soit une
conformation ramifiée, une conformation dendrimère, ou "un
15 cordon" linéaire de séquences d'amplification. Ces séquences
d'amplification sont utiles pour former des complexes
d'hybridation avec des sondes de marquage, et les ETM peuvent
être détectées en utilisant l'électrode.
20 En conséquence, la présente invention fournit des complexes de
dosage comprenant au moins une sonde d'amplification. Par
"sonde d'amplification" ou "multimère d'acide nucléique" ou
"multimère d'amplification" ou équivalents grammaticaux on
entend ici une sonde d'acide nucléique qui est utilisée pour
25 faciliter l'amplification du signal. Les sondes
d'amplification comprennent au moins une première séquence de
sonde d'acide nucléique simple brin, comme décrit ci-dessous,
et au moins une séquence d'amplification d'acide nucléique
simple brin, une multiplicité de séquences d'amplification
30 étant préférée.
Les sondes d'amplification comprennent une première séquence
de sonde qui est utilisée, soit directement soit
indirectement, pour s'hybrider à la séquence cible. C'est-à-
35 dire que la sonde d'amplification elle-même peut avoir une
première?séquence sonde qui soit sensiblement complémentaire à
la séquence cible (par exemple figure 5E) , ou elle a une146
première séquence sonde qui est sensiblement complémentaire à
une partie d'une sonde supplémentaire, dans ce cas appelée une
sonde succédanée de marquage, qui a une première partie qui
est sensiblement complémentaire à la séquence cible (par
5 exemple figures 5F' et 5D). Dans un mode de réalisation
préféré, la première séquence sonde de la sonde
d'amplification est sensiblement complémentaire à la séquence
cible, comme généralement représenté sur la figure 5E.
10 En général, comme pour toutes les sondes ici, la première
séquence sonde est d'une longueur -suffisante pour donner
spécificité et stabilité. Ainsi, en général, les séquences
sonde de l'invention qui sont conçues pour s'hybrider à un
autre acide nucléique (c'est-à-dire des séquences sonde, des
15 séquences d'amplification, des parties ou des domaines de
sonde plus grosses) sont d'au moins environ 5 nucleosides de
long, d'au moins environ 10 étant préférées et d'au moins
environ 15 étant spécialement préférées.
20 Dans un mode de réalisation préféré, les sondes
d'amplification, ou n'importe laquelle des autres sondes de
l'invention, peuvent former des structures tige-boucle en tête
d'épingle en l'absence de leurs cibles. La longueur de la
séquence à double brin en tige peut être sélectionnée de
25 manière à ce que la structure en tête d'épingle ne soit pas
favorisée en présence de la cible. L'utilisation de ce type de
sonde, dans les systèmes de l'invention ou dans n'importe quel
système de détection d'acide nucléique, peut résulter dans la
baisse significative de fixation non spécifique et ainsi dans
30 l'augmentation du taux de bruit dans le signal.
En général, ces structures en tête d'épingle comprennent
quatre composants. Le premier composant est une séquence de
fixation cible, c'est-à-dire une région complémentaire à la
35 cible (qui peut être la séquence cible de l'échantillon ou une
autre séquence sonde à laquelle on souhaite une fixation), qui
est longue de 10 nucleosides environ, d'environ 15 nucleosides147
étant préférée. Le deuxième composant est une séquence en
boucle qui peut faciliter la formation de boucles d'acide
nucléique. Sont particulièrement préférées dans ce but les
répétitions de GTC, qui ont été identifiées dans le syndrome
5 du X fragile comme formant des tours. (Quand des analogues PNA
sont utilisés, les tours comprenant des résidus de proline
peuvent être préférés) . En général, de trois à cinq
répétitions sont utilisées, de quatre à cinq étant préférées.
Le troisième composant est une région auto complémentaire, qui
10 a une première portion qui est complémentaire à une portion de
la région de séquence cible et une seconde portion qui
comprend une première portion de la séquence de fixation de la
sondes de marquage. Le quatrième composant est sensiblement
complémentaire à une sonde de marquage (ou d'autres sondes,
15 comme cela peut être le cas) . Le quatrième composant comprend
en plus une "extrémité adhesive", c'est-à-dire une partie qui
ne s ' hybride pas à toute autre partie de la sonde, et qui
contient de préférence la plupart des ETM, si ce n'est la
totalité. Comme 1'appréciera 1'homme du métier, n'importe
20 laquelle ou toutes les sondes décrites ici, peuvent être
configurées pour former des têtes d'épingle en l'absence de
leurs cibles, y compris les sondes d'amplification, de
capture, succédanées de capture, de marquage et succédanées de
marquage.
25
Dans un mode de réalisation préféré, beaucoup de sondes
d'amplification différentes sont utilisées, chacune ayant u ne
première séquence sonde qui va s'hybrider à une partie
différente de la séquence cible. C'est-à-dire qu'il y a plus
30 d'un niveau d'amplification ; la sonde d'amplification fournit
une amplification de signal due à une multiplicité
d'événements de marquage, et beaucoup de sondes différentes
d'amplification, chacune ayant cette multiplicité de
marquages, pour chaque fréquence cible sont utilisées. Ainsi,
35 des modes de réalisation préférés utilisent au moins deux
groupes différents de sondes d'amplification, chaque groupe
ayant une séquence sonde différente pour l'hybridation à148
différentes parties de la séquence cible ; la seule limitation
réelle sur le nombre des sondes d'amplification différentes va
être la longueur de la séquence cible originale. En outre, il
est aussi possible que les différentes sondes d'amplification
5 contiennent différentes séquences d'amplification, bien que
ceci ne soit pas généralement préféré.
Dans un mode de réalisation préféré, la sonde d'amplification
ne s'hybride pas directement à la séquence cible de
10 l'échantillon, mais s'hybride à la place à une première partie
de la sonde succédanée de marquage, comme généralement
représenté sur la figure 5F. Ceci est particulièrement utile
pour permettre l'utilisation de sondes d'amplification
"génériques", c'est-à-dire les sondes d'amplification qui
15 peuvent être utilisées avec une variété de cibles différentes.
Ceci peut être souhaitable puisque beaucoup des sondes
d'amplification requièrent des techniques de synthèse
spéciales. Ainsi, l'ajout d'une sonde relativement courte
comme une sonde succédanée de marquage est préféré. Ainsi, la
20 première séquence sonde de la sonde d'amplification est
sensiblement complémentaire à une première partie ou domaine
d'une première sonde d'acide nucléique simple brin succédanée
de marquage. La sonde succédanée de marquage contient aussi
une seconde partie ou domaine qui est sensiblement
25 complémentaire à une partie de la séquence cible. Ces deux
portions sont de préférence d'au moins environ 10 à environ 50
nucleotides de long, d'environ 15 à environ 30 étant préférés.
Les termes "premier" et "second" n'ont pas pour signification
de conférer une orientation des séquences en ce qui concerne
30 l'orientation 5'-3' des séquences cibles ou sondes. Par
exemple, considérant une orientation 5'-3' de la séquence
cible complémentaire, la première partie peut être localisée
soit en 5' de la deuxième partie, soit en 3' de la deuxième
partie. Pour une question de commodité, l'ordre des séquences
35 sonde est ici généralement de gauche à droite.149
Dans un mode de réalisation préféré, on peut utiliser plus
d'une paire de sondes succédanées de marquage sondes
d'amplification, c'est-à-dire que n est supérieur à un. C'est-
à-dire qu'une pluralité de sondes succédanées de marquage
5 peuvent être utilisées, chacune ayant une partie qui est
sensiblement complémentaire à une partie différente de la
séquence cible ; ceci peut servir comme un autre niveau
d'amplification. Ensuite, un mode de réalisation préféré
utilise des groupes d'au moins deux sondes succédanées de
10 marquage, la limite supérieure étant fixée par la longueur de
la séquence cible.
Dans un mode de réalisation préféré, plus d'une sonde
succédanée de marquage est utilisée avec une seule sonde
15 d'amplification pour réduire la fixation non spécifique, comme
représenté sur la figure 5G et expliqué de manière générale
dans le brevet U.S N° 5 681 697, incorporé à titre de
référence. Dans ce mode de réalisation, une première partie de
la première sonde succédanée de marquage s'hybride à une
20 première partie de la séquence cible, et la seconde partie de
la première sonde succédanée de marquage s'hybride à une
première séquence sonde de la sonde d'amplification. Une
première partie de la seconde sonde succédanée de marquage
s'hybride à une seconde partie de la séquence cible, et la
25 seconde partie de la seconde sonde succédanée de marquage
s'hybride à -une seconde séquence sonde de la sonde
d'amplification. Ces structures de formes auxquelles on fait
parfois référence sous le terme structures ou concentrations
"cruciformes" sont généralement effectuées pour conférer de la
30 stabilité quand de grosses sondes d'amplification
dendrimériques ou ramifiées sont utilisées.
En outre, comme l'appréciera l'homme du métier, les sondes
succédanées de marquage peuvent interagir avec une sonde de
35 préamplification, décrite ci-dessous, plutôt que directement
avec la sonde d'amplification.150
10
De même , comme expliqué ci-dessus, un mode de réalisation
préféré utilise beaucoup de sondes d'amplification
différentes, chacune ayant des premières séquences sonde qui
vont s 'hybrider à une portion différente de la sonde
succédanée de marquage. En outre, comme expliqué ci-dessous,
il est aussi possible que les différentes séquences sonde
?r
d'amplification contiennent différentes séquences
d'amplification, bien que ceci ne soit généralement pas
préféré.
En plus de la première séquence sonde, la sonde
d'amplification comprend aussi au moins une séquence
d'amplification. Une "séquence d'amplification" ou un "segment
d'amplification" ou équivalents grammaticaux signifie ici une
15 séquence qui est utilisée, soit directement soit
indirectement, pour se fixer à une première partie d'une sonde
de marquage comme décrit plus précisément ci-dessous. De
préférence, la sonde d'amplification comprend une multiplicité
de séquences d'amplification, d'environ 3 à environ 1000 étant
20 préférées, d'environ 10 à environ 100 étant particulièrement
préférées et d'environ 50 étant spécialement préférées. Dans
certains cas, par exemple quand les sondes d'amplification
linéaires sont utilisées, de 1 à environ 20 étant préférées,
d'environ 5 à environ 10 étant particulièrement préférées.
25
Les séquences d'amplification peuvent être liées les unes aux
autres selon une variété de moyens, comme l'appréciera l'homme
du métier. Elles peuvent être liées de manière covalente
directement les unes aux autres, ou à des séquences
30 intervenantes ou des groupes caractéristiques chimiques, au
travers de liaisons d'acides nucléiques comme des liaisons
phosphodiester des liaisons PNA, etc., ou au travers d'agents
de liaison interposés comme un acide aminé, de 1'hydrate de
carbone ou des ponts polyol, ou au travers d'autres agents de
35 reticulation ou partenaires de fixation. Le ou les sites de
liaisons peuvent être à la fin d'un segment, et/ou à un ou
plusieurs nucleotides internes dans le brin. Dans un mode de151
réalisation préféré, les séquences d'amplification sont
attachées par l'intermédiaire des liaisons d'acides
nucléiques.
5 Dans un mode de réalisation préféré, les sondes
d'amplification ramifiées sont utilisées, comme généralement
décrit dans le brevet U.S. N° 5 124 246. Les sondes
d'amplification.ramifiées peuvent prendre des conformations en
forme "de 'fourche" ou "de peigne". Les sondes ramifiées "en
10 fourche" ont généralement trois segments d'oligonucléotides ou
plus émanant d'un point d'origine pour former une structure
ramifiée. Le point d'origine peut être un autre segment de
nucleotides ou une molécule multifonctionnelle à laquelle au
moins trois segments peuvent être liés de manière covalente ou
15 fortement. Les sondes d'amplification ramifiées "en peigne"
ont un squelette linéaire avec une multiplicité
d'oligonucléotides de chaîne latérale qui s'étendent depuis le
squelette. Dans les deux conformations, les segments pendants
vont normalement dépendre d'un nucleotide modifié ou d'un
20 autre groupe caractéristique organique ayant des groupes
fonctionnels appropriés pour la liaison d'oligonucléotides. De
plus, dans les deux conformations, un grand nombre de
séquences d'amplification est disponible pour la fixation,
soit directement soit indirectement à des sondes de détection.
25 En général, ces structures sont faites comme il est connu dans
la technique, en utilisant des nucleotides multifonctionnels
modifiés, comme décrit dans les brevets U.S. N° 5 635 352 et
5 124 246 entre autres.
30 Dans un mode de réalisation préféré, les sondes
d'amplification dendrimères sont utilisées, comme généralement
décrit dans le brevet U.S. N° 5 175 270. Des sondes
d'amplification dendrimériques sont des séquences
d'amplification qui sont liées par hybridation, et ainsi ont
35 des points d'acide nucléique double brin comme composants de
leurs structures. La surface externe de la sonde152
d'amplification dendrimère a une multiplicité de séquences
d'amplification.
Dans un mode de réalisation préféré, les sondes
5 d'amplification linéaires sont utilisées, qui ont des
séquences d'amplification individuelles liées par leurs
extrémités soit directement soit avec de courtes séquences
d'intervention pour former un polymère. Comme pour les autres
configurations d'amplification, il peut y avoir des séquences
10 supplémentaires ou des groupes caractéristiques
supplémentaires entre les séquences d'amplification. En outre,
comme expliqué ici, les sondes d'amplification linéaires
peuvent former des structures tige-boucle en tête d'épingle,
comme représenté sur la figure 12.
15
Dans un mode de réalisation, la sonde d'amplification linéaire
a une seule séquence d'amplification. Ceci peut être utile
quand les cycles d'hybridation/dissociation ont lieu, formant
un groupe de sondes d'amplification qui était hybride à la
20 cible puis enlevé pour permettre à plus de sondes de se fixer,
ou quand de grands nombres d'ETM sont utilisés pour chaque
sonde de marquage. Cependant, dans un mode de réalisation
préféré, des sondes d'amplification linéaires comprennent une
multiplicité de séquences d'amplification.
25
En outre, la sonde d'amplification peut être totalement
linéaire, totalement ramifiée, totalement dendrimérique, ' ou
n'importe quelle combinaison de celle-ci.
30 Des séquences d'amplification de la sonde d'amplification sont
utilisées, soit directement soit indirectement, pour se fixer
à une sonde de marquage pour permettre la détection. Dans un
mode de réalisation préféré, les séquences d'amplification de
la sonde d'amplification sont sensiblement complémentaires à
35 une première partie de sonde de marquage. En variante, les
sondes succédanées d'amplification sont utilisées, qui ont une
première partie qui se fixe à la séquence d'amplification et153
une deuxième partie qui se fixe à la première partie de la
sonde de marquage.
En outre, les compositions de l'invention peuvent inclure des
5 molécules "de préamplification", qui servent de groupes
caractéristiques relieurs entre les molécules succédanées de
marquage et les sondes d'amplification. De cette manière, plus
d'amplificateurs et ainsi plus d'ETM sont finalement fixés aux
sondes de détection. Des molécules de préamplification peuvent
10 être soit linéaires soit ramifiées, " et contiennent
habituellement de 30 à 30000 nucleotides environ.
Les réactions expliquées ci-dessous peuvent être accomplies
selon une variété de moyens différents, comme 1'appréciera
15 1'homme du métier. Des composants de la réaction peuvent être
ajoutés simultanément, ou séquentiellement, dans n'importe
quel ordre, avec les modes de réalisation préférés expliqués
ci-dessous. En outre, la réaction peut comprendre une variété
d'autres réactifs qui peuvent être compris dans les dosages.
20 Ceux-ci comprennent des réactifs comme des sels, des tampons,
des protéines neutres, par exemple albumine, détergent, etc.
qui peuvent être utilisés pour faciliter l'hybridation
optimale et la détection optimale, et/ou réduire les
interactions non spécifiques ou d'arrière-plan de l'invention.
25 Des réactifs qui améliorent autrement 1'efficacité du dosage,
comme les inhibiteurs de protease, les inhibiteurs de
nuclease, les agents antimicrobiens, etc., peuvent aussi être
utilisés, selon les procédés de préparation d'échantillons et
la pureté de la cible.
30
En général, les procédés sont comme suit. Dans un mode de
réalisation préféré, la cible est initialement conduite dans
le voisinage de la sonde de détection en bas en utilisant
n'importe lequel des procédés expliqués ci-dessus. En général,
35 deux procédés peuvent être employés ; les complexes de dosage
comme décrit ci-dessous sont formés en premier (c'est-à-dire
que tous les composants solubles sont ajoutés ensemble, soit154
simultanément soit séquentiellement, y compris les sondes
succédanées de capture, les sondes de marquage, les sondes
d'amplification, les sondes succédanées de marquage, etc.), y
compris n'importe quel accélérateur d'hybridation, et ensuite
5 le complexe est ajduté à la surface pour la fixation à une
électrode de détection. En variante, la cible peut être
ajoutée, l'accélération d'hybridation a lieu pour permettre à
la cible de se fixer . au ligand de . fixation de capture et
ensuite les composants supplémentaires sont ajoutés pour
10 former le complexe de dosage. Ce dernier est décrit en détail
ci-dessous, mais toutes ces procédures peuvent être utilisées.
De même, certains composants peuvent être ajoutés, subir une
électrophorèse, et d'autres composants ajoutés ; par exemple,
l'analyte cible peut être combinée avec n'importe quelle sonde
15 succédanée de capture, puis transportée, etc. En outre, comme
expliqué ici, des étapes électrophorétiques peuvent être
utilisées pour effectuer des étapes de "lavage", au cours
desquelles les réactifs en excès (analytes non fixées, sondes
en excès, etc.) peuvent être conduites depuis la surface.
20
Dans un mode de réalisation préféré, des interactions non
spécifiques peuvent être réduites en utilisant de nombreux
procédés électrophorétiques. Dans un mode de réalisation
préféré, des sondes de marquage qui ne sont pas fixées
25 spécifiquement directement ou indirectement à une séquence
cible peuvent être enlevées de la surface par une impulsion
d'un champ électrique opposé, c'est-à-dire le champ électrique
est inversé pendant une certaine période de temps. La force du
champ électrique inversé est choisie de manière à ce que les
30 sondes de marquage spécifiquement fixées ne soient pas
enlevées (ou tout autre composant requis de la liaison et des
complexes de dosage).
Dans un mode de réalisation préféré, par exemple quand
35 I'électrophorèse est utilisée, les sondes de marquage ou les
ligands . de fixation de marquage comprenant les ETM
transportent une charge opposée à l'analyte cible. Ceci peut155
être effectué soit avec des sondes de marquage d'acide
nucléique soit avec des ligands de fixation de solution
chargés. Bien que la discussion se concentre sur les modes de
réalisation d'acide nucléique. Ceci peut être utile dans deux
5 systèmes différents'. Dans un mode de réalisation préféré,
l'analyte cible transporte un gros excès de charge, c'est-à-
dire une charge négative dans le cas d'un acide nucléique. La
fixation d'une ou plusieurs sondes de marquage chargées
positivement ne change pas significativement la charge
10 négative nette sur le complexe cible ; c'est-à-dire que la
cible va encore être attirée par la ? cathode. Cependant, des
sondes de marquage non fixées, ou des sondes de marquage non
spécifiquement fixées à la cible, sont repoussées, résultant
ainsi en une baisse de fixation non spécifique. Par exemple,
15 des squelettes PNA peuvent être modifiés pour transporter une
charge positive nette, et il y a d'autres analogues d'acides
nucléiques connus dans la technique qui sont chargés
positivement.
20 Dans un mode de réalisation préféré, la sonde de marquage a
une forte quantité de charge opposée, de manière à ce qu'en se
fixant à l'analyte cible, la charge nette de l'analyte cible
change. Ainsi, par exemple, pour les acides nucléiques, les
sondes de marquage transportent une charge positive suffisante
25 pour charger positivement le complexe d'analyte cible-sonde de
marquage. Ceci résulte dans le fait que l'analyte cible
spécifique est entraînée vers l'anode, mais tous les autres
éléments chargés négativement c'est-à-dire d'autres acides
nucléiques, vont être repoussés. Ceci est particulièrement
30 utile quand il y a un excès d'autres cibles présentes ; par
exemple, quand l'analyte cible est une espèce mineure d'un
grand excès d'autres acides nucléiques, par exemple.
Dans un mode de réalisation préféré, l'analyte cible est
35 initialement transporté par électrophorèse vers l'électrode de
détection, puis immobilisée ou liée à l'électrode de
détection. Dans un mode de réalisation préféré, ceci est156
effectué en formant un complexe de liaison (auquel on fait
fréquemment référence ici sous le terme de complexe
d'hybridation quand les composants d'acides nucléiques sont
utilisés) entre une sonde de capture et une partie de
5 l'analyte cible. Un' mode de réalisation préféré utilise des
ligands de fixation succédanés de capture (aussi appelés ici
sondes succédanées de capture) ; dans ce mode de réalisation,
un complexe., de liaison -est formé entre- une partie de 'la
séquence cible et une première partie d'une sonde succédanée
10 de capture, et un complexe de liaison supplémentaire entre une
seconde partie de la sonde succédanée de capture et une partie
de la sonde de capture. Des modes de réalisation préférés
supplémentaires utilisent des sondes de capture
supplémentaires, formant ainsi un complexe de liaison entre
15 une partie de la séquence cible et une première partie de la
seconde sonde succédanée de capture, et un complexe de liaison
entre une seconde partie de la seconde sonde de capture et une
seconde partie de la sonde de capture.
20 En variante, la liaison de la séquence cible à l'électrode est
faite simultanément avec les autres réactions.
Le procédé se poursuit avec l'introduction de sondes
d'amplification utilisées ici. Dans un mode de réalisation
25 préféré, la sonde d'amplification comprend une première
séquence sonde qui est sensiblement complémentaire à une
partie de la séquence cible, et au moins une séquence
d'amplification.
30 Dans un mode de réalisation, la première séquence sonde de la
sonde d'amplification est hybridée à la séquence cible, et
toute sonde d'amplification non hybridée est enlevée. Ceci
peut généralement être effectué comme connu dans la technique,
et dépend du type de dosage. Quand la séquence cible est
35 immobilisée sur une surface comme une électrode, on enlève
généralement les réactifs en excès par une ou plusieurs étapes
de lavage, comme l'appréciera l'homme du métier. Dans ce mode157
de réalisation, la cible peut être immobilisée sur n'importe
quel support solide. Quand la séquence cible n'est pas
immobilisée sur une surface, on peut enlever les réactifs en
excès comme les sondes de l'invention en ajoutant des billes
5 (c'est-à-dire des ' particules de support solides) qui
contiennent des séquences complémentaires aux sondes, de
manière à ce que les sondes en excès se fixent aux billes. Les
billes peuvent alors être enlevées, par exemple par la
centrifugation, la filtration, l'application de champs
10 magnétiques ou électrostatiques, etc.
Le mélange de réaction est alors soumis à des conditions
(température, haute salinité, changement de pH, etc.) dans
lesquelles la sonde d'amplification se dissocie de la séquence
15 cible, et la sonde d'amplification est collectée. La sonde
d'amplification peut alors être ajoutée à une électrode
comprenant des oligomères de capture pour les sondes
d'amplification, des sondes de marquage ajoutées et la
détection est réussie.
20
Dans un mode de réalisation préféré, un groupe plus gros de
sondes est créé en ajoutant plus de sondes d'amplification à
la séquence cible et les réactions hybridation/dissociation
sont répétées, pour générer un plus gros groupe de sondes
25 d'amplification. Ce groupe de sondes d'amplification est alors
ajouté à une électrode comprenant des sondes de capture
d'amplification, des sondes de marquage sont ajoutées et la
détection se poursuit.
30 Dans ce mode de réalisation, on préfère que la séquence cible
soit immobilisée sur un support solide, y compris une
électrode, en utilisant les procédés décrits ici ; bien que
comme l'appréciera l'homme du métier, des technologies de
liaisons de supports solides alternatives peuvent être
35 utilisées, comme la liaison à du verre, des polymères, etc. Il
est possible de faire la réaction sur un support solide et158
d'ajouter alors la sonde d'amplification groupée à une
électrode pour la détection.
Dans un mode de réalisation préféré, la sonde d'amplification
5 comprend une multiplicité de séquences d'amplification.
Dans un mode de réalisation, la première séquence sonde de la
sonde d'amplification est. hybridée à la séquence cible, et-
toute sonde d'amplification non hybridée est enlevée. A
10 nouveau, des modes de réalisation préférés utilisent des
séquences cibles immobilisées, dans lesquelles les séquences
cibles sont immobilisées par hybridation avec les sondes de
capture qui sont attachées à l'électrode, ou hybridation à des
sondes succédanées de capture qui s'hybrident à leur tour avec
15 des sondes de capture immobilisées comme décrit ici.
Généralement, dans ces modes de réalisation, les sondes de
capture et les sondes de détection sont immobilisées sur
l'électrode, généralement à la même "adresse".
20 Dans un mode de réalisation préféré, la première séquence
sonde de la sonde d'amplification est hybridée à une première
partie d'au moins une sonde succédanée de marquage, et une
seconde partie de la sonde succédanée de marquage est hybridée
à une partie de séquence cible. D'autres modes de réalisation
25 préférés utilisent plus d'une sonde succédanée de marquage,
comme généralement montré sur la figure 5G.
Dans un mode de réalisation préféré, les séquences
d'amplification de la sonde d'amplification sont utilisées
30 directement pour la détection, en hybridant au moins une
séquence sonde de marquage.
L'invention fournit alors des complexes de dosage qui
comprennent au minimum une séquence cible et une sonde de
35 marquage. "Complexe de dosage" signifie ici la collection de
complexe.de liaison ou d'hybridation comprenant des analytes,
y compris des ligands et des cibles de fixation, qui permet la159
détection. La composition du complexe de dosage dépend de
l'utilisation des différents composants de la sonde comme
expliqué ici. Ainsi, sur la figure 6A, le complexe de dosage
comprend la sonde de capture et les séquences cibles. Les
5 complexes de dosage peuvent aussi comprendre des sondes
succédanées de capture, des sondes succédanées de marquage, et
des sondes d'amplification, comme expliqué ici, selon la
configuration utilisée.
10 Les dosages sont généralement effectués dans des conditions de
stringence qui permettent la formation du complexe de liaison
de sonde de marquage seulement en présence d'une cible. La
stringence peut être contrôlée en altérant un paramètre
d'étape qui est une variable thermodynamique, y compris, mais
15 sans s'y limiter, la température, la concentration en
formamide, la concentration en sel, la concentration en sel
chaotropique, le pH, la concentration en solvant organique,
etc. La stringence peut aussi comprendre l'utilisation d'une
étape électrophorétique pour emmener les matériaux non
20 spécifiques (c'est-à-dire à basse stringence) loin de
l'électrode de détection.
Ces paramètres peuvent aussi être utilisés pour contrôler une
fixation non spécifique, comme généralement expliqué dans le
25 brevet U.S. N° 681 697. Ainsi il peut être souhaitable
d'effectuer certaines étapes à des conditions de stringence
supérieures ; par exemple quand une étape d'hybridation
initiale est faite entre la séquence cible et les sondes
succédanées de marquage et succédanées de capture. Le fait
30 d'effectuer cette étape à des conditions qui favorisent la
fixation spécifique peut permettre la réduction de fixation
non spécifique.
Dans un mode de réalisation d'acide nucléique préféré, quand
35 tous les composants expliqués ici sont utilisés, une méthode
préférée ? est comme suit. La séquence cible simple brin est
incubée dans des conditions d'hybridation avec les sondes160
succédanées de capture et les sondes succédanées de marquage.
Un mode de réalisation préféré effectue cette réaction en
présence de l'électrode avec des sondes de capture
immobilisées, bien que ceci puisse être fait en deux étapes,
5 avec l'incubation ' initiale et l'addition ultérieure à
l'électrode. Des réactifs en excès sont enlevés par lavage, et
des sondes d'amplification sont alors ajoutées. Si les sondes
de préamplification sont utilisées, .elles -peuvent- être
ajoutées -soit avant les sondes d'amplification soit
10 simultanément avec les sondes d'amplification. Les réactifs en
excès sont enlevés par lavage, et les- sondes de marquage sont
alors ajoutées. Les réactifs en excès.sont enlevés par lavage,
et la détection se poursuit comme expliqué ci-dessous.
15 Dans un mode de réalisation, un certain nombre de sondes de
capture (ou sondes de capture et sondes succédanées de
capture) qui sont chacune sensiblement complémentaires à une
partie différente de la séquence cible sont utilisées.
20 A nouveau, comme expliqué ici, quand les sondes
d'amplification sont utilisées, le système est généralement
configuré de' manière à ce que pour la fixation de sonde de
marquage, les lieurs de recrutement comprenant les ETM sont
placés à proximité soit de la surface de la couche
25 monomoléculaire contenant les oligomères conducteurs
(mécanisme 2) soit à proximité des sondes de détection. Ainsi
par exemple, pour les systèmes de mécanisme 2, quand les ETM
sont liées par l'intermédiaire des structures types
"dendrimères" comme expliqué ici, la longueur des lieurs du
30 point de liaison de l'acide nucléique aux ETM peut varier, en
particulier avec la longueur de la sonde de capture quand les
sondes succédanées de capture sont utilisées. C'est-à-dire que
les sondes de capture plus longues, avec les succédanées de
capture, peuvent résulter en des séquences cibles étant
35 "portées" plus loin de la surface que pour les sondes de
capture plus courtes. L'ajout d'extra-séquences de liaison
entre l'acide nucléique sonde et les ETM peut avoir pour161
résultat que les ETM sont spatialement plus proches de la
surface, ce qui donne de meilleurs résultats. De manière
similaire pour les systèmes de mécanisme 1, la longueur du
lieur de recrutement, la longueur de la sonde de détection, et
5 leurs distances, peuvent être optimisées.
En outre, si c'est souhaitable, des acides nucléiques utilisés
dans la présente invention peuvent.- aussi être ligaturés"
ensembles avant la détection, si applicable, en utilisant les
10 techniques de biologie moléculaire standard comme
l'utilisation d'une ligase. De même, si cela est souhaitable
pour la stabilité, des agents réticulants peuvent être ajoutés
pour maintenir les structures stables.
15 Comme l'appréciera l'homme du métier, alors qu'ils sont
décrits pour des acides nucléiques, les systèmes expliqués ici
peuvent aussi être utilisés pour d'autres analytes cibles.
Les compositions de 1'invention sont généralement synthétisées
20 comme expliqué ci-dessous et dans U.S.S.N. 08/743 798, 08/873
97 8, 08/911 085, 08/911 085 et PCT US97/20014, en utilisant
généralement des techniques bien connues dans la technique.
Comme l'appréciera l'homme du métier, de nombreuses techniques
expliquées ci-dessous sont dirigées vers des acides nucléiques
25 contenant un squelette ribose-phosphate. Cependant, comme
expliqué ci-dessus, de nombreux analogues d'acides nucléiques
peuvent être utilisés en variante, certains d'entre eux
peuvent ne pas contenir soit du ribose soit du phosphate dans
leur squelette. Dans ces modes de réalisation, pour une
30 liaison à des positions autres qu'à la base, une liaison est
effectuée, comme l'appréciera l'homme du métier, selon le
squelette. Ainsi, par exemple, la liaison peut être faite sur
les atomes carbone du squelette PNA, comme décrit ci-dessous,
ou à chacune des extrémités du PNA.
35
Des compositions peuvent être effectuées de plusieurs manières
différentes. Un procédé préféré synthétise en premier un162
oligomère conducteur lié à un nucleoside, avec ajout de
nucleosides supplémentaires pour former la sonde de capture,
suivi par la liaison à l'électrode. En variante, la sonde de
capture entière peut être faite et l'oligomère conducteur
5 complété est alors ajouté, suivi de la liaison à l'électrode.
En variante, une couche monomoléculaire d'oligomères
conducteurs (certains desquels ont des groupes fonctionnels
pour la liaison de sondes de capture) est liée en premier à
1'électrode, suivie de la liaison de la sonde de capture. Les
10 deux derniers procédés peuvent être très serrés quand les
oligomères conducteurs sont utilisés et qu'ils ne sont pas
stables dans les solvants et dans des conditions utilisées
dans la synthèse d'acide nucléique traditionnelle.
15 Dans un mode de réalisation préféré, les compositions de
l'invention sont faites en formant tout d'abord l'oligomère
conducteur lié de manière covalente aux nucleosides, puis de
l'ajout de nucleosides supplémentaire pour former un acide
nucléique de sonde de capture, avec la dernière étape
20 comprenant l'ajout de l'oligomère conducteur à l'électrode.
La liaison de 1'oligomère conducteur au nucleoside peut être
effectuée de plusieurs manières différentes. Dans un mode de
réalisation préféré, tout ou partie de l'oligomère conducteur
25 est synthétisé tout d'abord (généralement avec un groupe
fonctionnel sur la fin pour la liaison à l'électrode), qui est
ensuite lié au nucleoside. Des nucleosides supplémentaires
sont alors ajoutés si nécessaire, la dernière étape étant
généralement la liaison à l'électrode. En variante, des unités
30 d'oligomères sont ajoutées une à la fois au nucleoside, avec
ajout de nucleosides additionnels et liaison à l'électrode. Un
certain nombre de synthèses représentatives sont montrées sur
les figures des documents WO 98/20162 ; PCT/US98/12430 ;
PCT/US98/12082 ; PCT/US99/01705 ; PCT/US99/01703 ; et
35 U.S.S.N. 09/135 183 ; 60/105 875 : et 09/295 691.163
L'oligomère conducteur est alors attaché à un nucleoside qui
peut contenir une (ou plusieurs) des unités oligomères, liées
comme représenté ici.
5 Dans un mode de réalisation préféré, la liaison se fait sur un
ribose du squelette ribose-phosphate, y compris les liaisons
amide et amine. Dans un mode de réalisation préféré, il y a au
moins un groupe méthylène ou d'autres groupes alkyle
aliphatiques" courts (en tant que groupe Z) entre l'azote liée
10 au ribose et l'anneau aromatique de l'oligomère conducteur.
En variante, la liaison se fait par l'intermédiaire d'un
phosphate du squelette ribose phosphate, comme généralement
expliqué dans PCT U.S. 97/20014.
15
Dans un mode de réalisation préféré, la liaison se fait par
1'intermédiaire de la base. Dans un mode de réalisation
préféré, des groupes de protection peuvent être rajoutés à la
base avant l'ajout des oligomères conducteurs, comme
20 généralement connu dans la technique. En outre, les réactions
de couplages croisés du palladium peuvent être altérées pour
empêcher les problèmes de dimérisation ; c'est-à-dire la
dimérisation de deux oligomères conducteurs, plutôt que le
couplage à la base.
25
En variante, la liaison à la base peut être faite en créant le
nucleoside avec une unité de l'oligomère, suivi de l'ajout des
autres.
30 Une fois que les nucleosides modifiés sont préparés, protégés
et activés, avant la liaison à l'électrode, ils peuvent être
incorporés dans un oligonucleotide en croissance par des
techniques synthétiques standard (Gait, Oligonucleotide
Synthesis : A Practical Approach, IRL Pres, Oxford, UK 1984 ;
35 Eckstein) de plusieurs manières différentes.164
Dans un mode de réalisation, un ou plusieurs nucleosides
modifiés sont transformés sous forme triphosphate et
incorporés dans une chaîne oligonucléotidique en croissance en
utilisant les techniques de biologie moléculaire standard
5 comme avec 1'utilisation de l'enzyme ADN polymerase I, T4 ADN
polymerase, T7 ADN polymerase, Taq ADN polymerase,
?.transcriptase inverse, et des ARN polymerase. Pour
l'incorporation d'un nucleoside modifié en 3' à un _acide
nucléique,'la désoxynucléotidyltransférase terminale peut être
10 utilisée. (Rattliff, Terminal deoxynucleotidyltransferase. In
The Enzymes, Volume 14A. P.D. Boyer ed. pages 105 à 118.
Academic Press, San Diego, CA. 1981) . Ainsi, la présente
invention fournit des triphosphates de désoxyribonucléoside
comprenant une ETM liée de manière covalente. Des modes de
15 réalisation préférés utilisent une liaison ETM à la base ou au
squelette, comme le ribose (de préférence en position 2')
comme représenté généralement ci-dessous dans les structures
42 et 43 :
20 Structure 42
OOO
o
\
Ct\ b**e?Z?ETM
Ainsi, dans certains modes cie réalisation, il peut être
25 possible de créer des acides nucléiques comprenant des ETM in
situ. Par exemple, une séquence cible peut s'hybrider à une165
sonde de capture (par exemple à la surface) de telle manière
que l'extrémité de la séquence cible est exposée, c'est-à-dire
non hybridée. L'ajout d'enzymes et de nucleotides triphosphate
marqués avec les ETM permet la création in situ du marquage.
5 De manière similaire, l'utilisation de nucleotides marqués
reconnus par les polymerases peut permettre un PCR et une
détection simultanés ; c'est-à-dire que les séquences cibles
sont créées in situ. , . - -
10 Dans un mode de réalisation préféré, le nucleoside modifié est
transformé sous la forme de phosphoramidite ou H-phosphonate,
il peut être utilisé dans des synthèses de phases solides ou
de solution's d'oligonucléotides. De cette manière, le
nucleoside modifié, soit par liaison au ribose (c'est-à-dire
15 des nucleosides amino- ou thiol- modifiés) ou à la base, est
incorporé dans l'oligonucléotide soit sur une position interne
soit sur l'extrémité 5'. Ceci est généralement effectué d'une
manière sur deux. Premièrement, la position 5' du ribose avec
le 4', 4-diméthoxytrityl (DMT) suivi par la réaction avec soit
20 2-cyanoéthoxy-bis-diisopropylaminophosphine en présence de
tétrazolide diisopropylammonium, soit par réaction avec
chlorodiisopropylamino 2'-cyanoéthyoxyphosphine, pour donner
la phosphoramidite comme connu dans la technique ; bien que
d'autres techniques puissent être utilisées comme l'appréciera
25 l'homme du métier. Voir Gait, supra ; Caruthers, Science
230:281 (1985).
Pour une liaison avec un groupe sur l'extrémité 3', un procédé
préféré utilise la liaison du nucleoside modifié (ou le
30 remplacement de nucleoside) à un verre de pore contrôlé (CPG)
ou d'autres supports oligomer ique s. Dans ce mode de
réalisation, le nucleoside modifié est protégé à l'extrémité
5' avec DMT, puis il est mis à réagir avec de l'anhydride
succinique avec activation. Le composé succinyle résultant est
35 lié au CPG ou à d'autres supports oligomériques connus dans la
technique. D'autres nucleosides phosphoramidite sont ajoutés,
modifiés ou non, à l'extrémité 5' après que la protection a166
cessé. Ainsi, la présente invention fournit des oligomères
conducteurs ou des isolateurs liés de manière covalente à des
nucleotides liés à des supports oligomériques solides comme le
CPG et des dérivés phosphoramidite des nucleosides de
5 l'invention. '
L'invention fournit aussi des procédés pour créer des sondes
de marquage avec des lieurs de réaction., comprenant des ETM.
Ces récepteurs synthétiques vont dépendre du caractère du
10 lieur de recrutement et du procédé de liaison des ETM, comme
1'appréciera 1'homme du métier. Pour les lieurs de recrutement
d'acide nucléique, les sondes de marquage sont généralement
faites comme expliqué ici avec l'incorporation des ETM à une
ou plusieurs positions. Quand un complexe de métal de
15 transition est utilisé comme ETM, la synthèse peut avoir lieu
, de plusieurs manières. Dans un mode de réalisation préféré, le
ou les ligands sont ajoutés à un nucleoside, suivi de l'ion
métallique de transition, puis le nucleoside avec le complexe
de métal de transition lié est ajouté un oligonucleotide,
20 c'est-à-dire par ajout à un synthétiseur d'acide nucléique. En
variante, le ou les ligands peuvent être attachés, suivis de
l'incorporation dans une chaîne oligonucléotidique en
croissance, suivi de l'ajout de l'ion métallique.
25 Dans un mode de réalisation préféré, les ETM sont liées à un
ribose du squelette ribose-phosphate. Ceci est généralement
effectué comme expliqué ici pour les oligomères conducteurs,
comme décrit ici, et dans la publication PCT du document WO
95/15971, en utilisant les nucleosides amino modifiés ou oxo
30 modifiés, en position soit 2' soit 3' du ribose. Le groupe
amino peut alors être utilisé soit comme un ligand, par
exemple comme un ligand de métal de transition pour la liaison
d'un ion métallique, soit comme un groupe chimiquement
fonctionnel qui peut être utilisé pour la liaison d'autres
35 ligands ou ETM organiques, par exemple par l'intermédiaire des
liaisons .amide, comme l'appréciera l'homme du métier. Par167
exemple, les exemples décrivent la synthèse de nucleosides
avec une variété d'ETM liées par l'intermédiaire du ribose.
Dans un mode de réalisation préféré, les ETM sont liées à un
5 phosphate du squelette ribose-phosphate. Comme expliqué ici,
ceci peut être effectué en utilisant des analogues
phosphodiesters comme liaisons phosphoramidite, voir de
manière générale la publication WO 95/15971, ou peut être
"" effectué d'une manière similaire à celle décrite dans PCT
10 US97/20014, où l'oligomère conducteur est" remplacé par un
ligand de métal de transition ou un complexe ou une ETM
organique.
La liaison à des squelettes alternés, par exemple des acides
15 nucléiques peptidiques ou des liaisons phosphate alternatives
va être faite comme l'appréciera l'homme du métier.
Dans mode de réalisation préféré, les ETM sont liées à une
base du nucleoside. Ceci peut être effectué selon une variété
20 de moyens différents. Dans un mode de réalisation, des groupes
amino de la base, soit naturels soit ajoutés comme décrit ici
(voir les figures, par exemple) sont utilisés comme ligands
pour les complexes de métal de transition ou comme un groupe
chimiquement fonctionnel qui peut être utilisé pour ajouter
25 d'autres ligands, par exemple par l'intermédiaire d'une
liaison amide, ou des ETM organiques. Ceci est effectué comme
l'appréciera l'homme du métier. En variante, des nucleosides
contenant des atomes halogène liés à un anneau hétérocyclique
sont disponibles dans le commerce. Des ligands liés
30 d'acétylène peuvent être ajoutés en utilisant des bases
halogénées, comme généralement montré ; voir par exemple
Tzalis et al., Tetrahedron Lett. 36 (34) : 6017-6020 (1995) ;
Tzalis et al-, Tetrahedron Lett. 36(2):3489-3490 (1995) ; et
Tzalis et al. Chem. Communications (dans la presse) 1996. Voir
35 aussi les figures et les exemples, qui décrivent la synthèse
de métallocènes (dans ce cas, ferrocene) liés par
l'intermédiaire des liaisons acétylène aux bases.168
Dans un mode de réalisation, les nucleosides sont effectués
avec les ligands de métal de transition incorporés dans un
acide nucléique, puis l'ion de métal de transition et tous
5 ligands nécessaires 'restants sont ajoutés comme connu dans la
technique. Dans un autre mode de réalisation, l'ion de métal
de transition et les ions supplémentaires sont ajoutés avant
l'incorporation dans l'acide nucléique. - - -
10 Une fois que les acides nucléiques de l'invention sont faits,
avec un lieur de liaison lié de manière covalente (c'est-à-
dire soit un isolateur soit un oligomère conducteur), le lieur
de liaison est lié à 1 ' électrode. Le procédé va varier selon
le type d'électrode utilisé. Comme décrit ici, les lieurs de
15 liaison sont généralement faits avec un lieur "A" terminal
pour faciliter la liaison à l'électrode. Pour les buts de
cette demande, une liaison soufre-or est considérée comme une
liaison covalente.
20 Dans un mode de réalisation préféré, des oligomères
conducteurs, des isolateurs et des lieurs de liaison sont liés
de manière covalente par l'intermédiaire des liaisons de
soufre à l'électrode. Cependant, de manière surprenante, les
groupes de protection traditionnels pour l'utilisation des
25 molécules liantes à des électrodes en or ne sont en général
pas idéaux pour l'utilisation tant dans la synthèse des
compositions décrites ici que dans l'inclusion dans les
réactions synthétiques d'oligonucléotides. En conséquence, la
présente invention fournit de nouveaux procédés pour la
30 liaison d'oligomères conducteurs aux électrodes en or, en
utilisant des groupes de protection non habituels, y compris
1'éthylpyridine, et le triméthylsilyléthyle comme représenté
sur les figures. Cependant, comme l'appréciera l'homme du
métier, quand les oligomères conducteurs ne contiennent pas
35 d'acide nucléique, des groupes de protection traditionnels
comme les groupes acétylène et d'autres peuvent être utilisés.
Voir Greene et al., supra.169
Ceci peut être effectué de plusieurs manières différentes.
Dans un mode de réalisation préféré, la sous-unité de
l'oligomère conducteur qui contient l'atome de soufre pour la
5 liaison à l'électrode est protégée avec un groupe
éthylpyridine ou triméthylsilyléthyle. Pour le premier, ceci
est fait en général en mettant en contact la sous-unité
contenant l'atome de soufre (de préférence sous la forme d'un
sulfhydrile) avec un groupe vinylpyridine ou un groupe
10 vinyltriméthylsilyléthyle dans des conditions dans lesquelles
un groupe éthylpyridine ou un groupe triméthylsilyléthyle est
ajouté à l'atome de soufre.
Cette sous-unité contient aussi généralement un groupe
15 caractéristique fonctionnel pour la liaison de sous-unités
supplémentaires, et ainsi des sous-unités supplémentaires sont
liées pour former l'oligomère conducteur. L'oligomère
conducteur est alors lié à un nucleoside, et des nucleosides
supplémentaires sont liés. Le groupe de protection est alors
20 enlevé et la liaison covalente soufre-or est effectuée. En
variante, tout ou partie de l'oligomère conducteur est
effectuée, puis soit une sous-unité contenant un atome de
soufre protégé est ajoutée, soit un atome de soufre est ajouté
puis protégé. L'oligomère conducteur est alors lié au
25 nucleoside, et les nucleosides supplémentaires liés. En
variante, l'oligomère conducteur lié à un acide nucléique est
effectué, puis soit une sous-unité contenant un atome de
soufre protégé est ajoutée, soit un atome de soufre est ajouté
puis protégé. En variante, le groupe de protection
30 éthylpyridine peut être utilisé comme ci-dessus, mais enlevé
après une ou plusieurs étapes et remplacé par un groupe de
protection standard comme un disulfide. Ainsi, le groupe
éthylpyridine ou triméthylsilyléthyle peut servir comme groupe
de protection pour certaines des réactions synthétiques, puis
35 peut être enlevé et remplacé par un groupe de protection
traditionnel.170
10
Par "sous-unité" de polymère conducteur on entend ici au moins
le groupe caractéristique de l'oligomère conducteur auquel
l'atome de soufre est lié, bien que des atomes supplémentaires
peuvent être présents, y compris soit les groupes fonctionnels
qui permettent l'ajout de composants supplémentaires de
l'oligomère conducteur, soit des composants supplémentaires de
l'oligomère conducteur. Ainsi, par exemple, quand des
oligomères de structure 1 sont utilisés,- une- sous-unité
comprend au moins le premier groupe Y.
Un procédé préféré comprend 1) l'ajout d'un groupe de
protection éthylpyridine ou triméthylsilyléthyle à un atome de
soufre lié à une première sous-unité d'oligomères conducteurs,
généralement effectué par 1'addition d'un groupe vinylpyridine
15 ou triméthylsilyléthyle à un sulfhydrile ; 2) l'ajout de sous-
unités supplémentaires pour former l'oligomère conducteur ; 3)
l'ajout d'au moins un premier nucleoside à un oligomère
conducteur ; 4) l'ajout de nucleosides supplémentaires au
premier nucleoside pour former un acide nucléique ; 5) la
20 liaison de l'oligomère conducteur à l'électrode en or. Ceci
peut aussi être fait en l'absence de nucleosides, comme décrit
dans les Exemples.
Le procédé ci-dessus peut aussi être utilisé pour lier les
25 molécules d'isolateur à une électrode en or.
Dans un mode de réalisation préféré, une couche
monomoléculaire comprenant des oligomères conducteurs (et
facultativement des isolateurs) est ajoutée à l'électrode. En
30 général, la chimie de l'ajout est similaire ou la même que
celle de l'ajout d'oligomères conducteurs à l'électrode,
c'est-à-dire en utilisant un atome de soufre pour la liaison à
une électrode en or, etc. Les compositions comprenant des
couches monomoléculaires en plus des oligomères conducteurs
35 liés de manière covalente aux acides nucléiques peuvent être
effectuées dans au moins un moyen parmi cinq : 1) ajout de la
couche monomoléculaire, suivi de l'ajout ultérieur du complexe171
acide nucléique-lieur de liaison ; 2) ajout du complexe acide
nucléique-lieur de liaison suivi de l'ajout de la couche
monomoléculaire ; 3) ajout simultané de la couche
monomoléculaire et du complexe acide nucléique-lieur de
5 liaison ; 4) formation d'une couche monomoléculaire (en
utilisant 1, 2 ou 3) qui comprend des lieurs de liaison qui se
terminent par un groupe caractéristique fonctionnel convenable
pour la liaison d'un acide nucléique complété ; ou- 5)
formation d'une couche monomoléculaire qui comprend des lieurs
10 de liaison qui se terminent par un groupe caractéristique
fonctionnel convenable pour une synthèse d'acide nucléique,
c'est-à-dire que l'acide nucléique est synthétisé à la surface
de la couche monomoléculaire comme connu dans la technique. De
tels groupes caractéristiques fonctionnels convenables
15 comprennent, mais sans s'y limiter, des nucleosides, des
groupes amino, des groupes carboxyle, des groupes sulfuriques
protégés, ou des groupes hydroxyle pour des ajouts de
phosphoramidite. Les exemples décrivent la formation d'une
couche monomoléculaire sur 1'électrode en or en utilisant le
20 procédé préféré (1).
Dans un mode de réalisation préféré, l'acide nucléique est un
acide nucléique peptidique ou analogues. Dans ce mode de
réalisation, l'invention fournit des acides nucléiques
25 peptidiques avec au moins une ETM liée de manière covalente ou
un lieur de liaison. Dans un mode de réalisation préféré, ces
groupes caractéristiques sont liés de manière covalente à une
sous-unité monomérique du PNA. Par "sous-unité monomérique de
PNA" on entend ici que le monomère -NH-CH2CH2-N (COCH2-Base) -
30 CH2-CO-, ou dérivés (inclus ici dans la définition de
"nucleoside") de PNA. Par exemple, le nombre d'atomes de
carbone dans le squelette PNA peut être altéré ; voir en
général Nielsen et al., Chem. Soc. Rev. 1997 page 73, qui
décrit un certain nombre de dérivés PNA. De manière similaire,
35 la liaison amide liant la base au squelette peut être
altérée ;. les liaisons phosphoramidé et sulfuramide peuvent
être utilisées. En variante, les groupes caractéristiques sont172
liés à une sous-unité monomérique interne. Par "interne" on
entend ici que la sous-unité monomérique n'est pas soit la
sous-unité monomérique terminale N soit la sous-unité
monomérique terminale C. Dans ce mode de réalisation, les
5 groupes caractéristiques peuvent être liés soit à une base
soit au squelette de la sous-unité monomérique. La liaison à
la base est effectuée comme expliqué ici ou montré dans les
ouvrages. En général, l_es groupes -caractéristiques sont
ajoutés à 'une base qui est alors incorporée dans un PNA comme
10 expliqué ici. La base peut être soit protégée, comme
nécessaire pour l'incorporation dans la réaction synthétique
de PNA, soit dérivée, pour permettre l'incorporation, soit
avant l'ajout du substitution chimique soit après. La
protection et la dérivation des bases sont montrées dans PCT
15 US97/20014. Les bases peuvent alors être incorporées dans des
sous-unités monomériques.
Dans un mode de réalisation préféré, les groupes
caractéristiques sont liés de manière covalente au squelette
20 du monomère de PNA. La liaison se fait généralement sur l'un
des atomes de carbone non substitué de la sous-unité
monomérique, de préférence le carbone-a du squelette, bien que
la liaison qui se fait soit sur les positions 1 ou 2 du
carbone, soit sur le carbone-a de la liaison amide liant la
25 base au squelette, puisse être effectuée. Dans le cas des
analogues PNA, d'autres carbones ou d'autres atomes peuvent
aussi être substitués. Dans un mode de réalisation préféré,
des groupes caractéristiques sont ajoutés aux atomes de
carbone-a, soit à une sous-unité monomérique terminale soit à
30 une sous-unité monomérique interne.
Dans ce mode de réalisation, une sous-unité monomérique
modifiée est synthétisée avec une ETM ou un lieur de liaison,
ou un groupe fonctionnel pour sa liaison, puis la base est
35 ajoutée et le monomère modifié peut être incorporé dans une
chaîne PNA en croissance.173
Une fois créées, les sous-unités monomériques avec des groupes
caractéristiques liés de manière covalente sont incorporées
dans un PNA en utilisant les techniques expliquées dans Will
et al., Tetrahedron 51 (44); 12069-12082 (1985) et Vanderlaan et
5 al., Tett. Let. 38:2249-2252 (1997). Ces procédures permettent
l'ajout de substituants chimiques à des acides nucléiques
peptidiques sans détruire les substituants chimiques.
Comme l'appréciera l'homme du métier, on peut faire des
10 électrodes qui ont n'importe quelle combinaison d'acide
nucléique, d'oligomères conducteurs et d'isolateurs.
Les compositions de l'invention peuvent contenir en plus une
ou plusieurs marques à n'importe quelle positions. Par
15 "marque" on entend ici un élément (par exemple un isotope), ou
un composé chimique qui est lié pour permettre la détection du
composé. Les marques préférées sont des marques isotopiques
radioactives, et des teintures colorées ou fluorescentes. Les
marques peuvent être incorporées dans le composé à n'importe
20 quelle position. En outre, les compositions de l'invention
peuvent aussi contenir d'autres groupes caractéristiques comme
des agents réticulants pour faciliter la liaison croisée du
complexe cible-sonde. Voir par exemple Lukhtanov et al. Nucl.
Acids. Résistance. 24(4)-.683 (1996) et Tabone et al., Biochem.
25 33:375 (1994).
Une fois créées, les compositions trouvent une utilité dans un
certain nombre d'applications, comme décrit ici. En
particulier, les compositions de 1'invention trouvent une
30 utilité dans les dosages de fixation pour la détection des
analytes cibles, en particulier les séquences cibles d'acide
nucléique. Comme l'appréciera l'homme du métier, on peut créer
des électrodes qui ont une seule espèce de ligand de fixation,
ou une multiplicité d'espèces de ligands de fixation, c'est-à-
35 dire dans un format de gamme.174
En outre, comme expliqué ici, l'utilisation d'un support
solide comme une électrode permet l'utilisation de ces dosages
sous une forme de gamme. Par exemple, l'utilisation de gammes
oligonucleotides est bien connue dans la technique. En outre,
5 des techniques sont'connues pour "adresser" des localisations
à l'intérieur d'une électrode et pour la modification de
surface des électrodes. Ainsi, dans un mode de réalisation
préféré, des gammes de ligands_ .de fixation -différents? y
compris des acides nucléiques, sont placés sur l'électrode,
10 chacun étant lié de manière covalente à l'électrode par
l'intermédiaire d'un lieur de liaison. Dans ce mode de
réalisation, le nombre des ligands de fixation différents peut
varier largement, de un à des milliers, d'environ 4 à environ
100 000, étant préféré, et d'environ 10 à environ 10 000 étant
15 particulièrement préféré.
Une fois que les complexes de dosage de 1 ' invention sont
faits, qui comprennent au moins une analyte cible et une sonde
de marquage, la détection se poursuit avec l'initiation
20 électronique. Sans être limitée par le mécanisme ou la
théorie, la détection est basée sur le transfert des électrons
de l'ETM à l'électrode, y compris par l'intermédiaire du
"chemin-TC".
25 La détection du transfert d'électrons, c'est-à-dire la
présence des ETM, est généralement initiée électroniquement,
le voltage étant préféré. Un potentiel est appliqué au
complexe de dosage. Un contrôle et des variations précis du
potentiel appliqué peuvent être effectués par l'intermédiaire
30 d'un potentiostat et soit un système à trois électrodes (une
référence, un échantillon (ou travail) et une électrode
auxiliaire) soit un système à deux électrodes (un échantillon
et une électrode auxiliaire). Ceci permet l'association de
potentiels appliqués au potentiel maximum du système qui
35 dépend en partie du choix des ETM et en partie de l'oligomère
conducteur utilisé, la composition et l'intégrité de la couche175
10
monomoléculaire, et du type d'électrode de référence utilisé.
Comme décrit ici, le ferrocene est une ETM préféré.
Dans un mode de réalisation préféré, un co-réducteur ou co-
oxydant (collectiverrient co-redoxant) est utilisé, en tant que
source ou perte d'électrons supplémentaires. Voir en général
?*
Sato et al. Bull. Chem. Soc. Jpn 66:1032 (1993) ; Uosaki et
al., Electrochimica Acta 36:179.9 (1991) ;- et- Alleman- et al.,
J. Phys. Chem 100:17050 (1996).
Dans un mode de réalisation préféré, une source d'électron
entrant dans la solution est utilisée dans l'initiation du
transfert électronique, de préférence quand l'initiation et la
détection sont en cours d'exécution en utilisant des
15 fréquences de courant DC ou AC là ou la diffusion n'est pas
limitative. En général, comme l'appréciera l'homme du métier,
les modes de réalisation préférés utilisent des couches
monomoléculaires qui contiennent un minimum de "trous", de
manière à éviter de court-circuiter le système. Ceci peut être
20 effectué par plusieurs moyens généraux. Dans un mode de
réalisation préféré, on utilise une source d'électron entrant
qui a un potentiel redox inférieur ou similaire à l'ETM de la
sonde de marquage. Ainsi, à des voltages en dessus du
potentiel redox de la source d'électron entrant, l'ETM et la
25 source d'électron entrant sont oxydées et peuvent alors donner
des électrons ; 1'ETM donne un électron à 1'électrode et la
source entrant donne à l'ETM. Par exemple, le ferrocene, en
tant qu'ETM lié aux compositions de l'invention comme décrit
dans les exemples, a un potentiel redox d'à peu près 200 mV en
30 solution aqueuse (qui peut changer significativement selon ce
à quoi le ferrocene est lié, la manière de la liaison et la
présence des groupes de substitution quels qu'ils soient. Le
ferrocyanide, une source d'électron, a un potentiel redox d'à
peu près 200 mV aussi (en solution aqueuse). En conséquence, à
35 des voltages d'à peu près 200 mV ou supérieurs, le ferrocene
se transforme en ferricenium, qui transfère alors un électron
à l'électrode. Le ferrocyanide peut maintenant être oxydé pour176
10
transférer un électron à l'ETM. De cette manière, la source
d'électron (ou co-réducteur) sert à amplifier le signal généré
dans le système, comme les molécules de la source d'électron
donnent rapidement et de manière répétée des électrons à l'ETM
liée à l'acide nucléique. Le taux de donation ou d'acceptation
d'électrons va être limité par le taux de diffusion du co-
réducteur, le transfert d'électrons entre le co-réducteur et
l'ETM, qui à son tour est affecté par la concentration et" la
taille, etc.
En variante, des sources d'électrons- entrantes qui ont des
potentiels redox inférieurs à l'ETM sont utilisées. A des
voltages inférieurs au potentiel redox de l'ETM, mais
supérieurs au potentiel redox de la source d'électron, la
15 source entrante comme le ferrocyanide est incapable d'être
oxydée et est ainsi incapable de donner un électron à l'ETM ;
c'est-à-dire qu'aucun transfert électronique n'a lieu. Une
fois que le ferrocene est oxydé, il existe alors un chemin
pour le transfert électronique.
20
Dans un autre mode de réalisation préféré, on utilise une
sonde d'électron entrante qui a un potentiel redox supérieur à
1 ' ETM de la sonde de marquage. Par exemple, le luminol, une
source d'électron, a un potentiel redox d'à peu près 720 mV. A
25 des voltages supérieurs au potentiel redox de l'ETM, mais
inférieurs au potentiel redox de la source d'électron, c'est-
à-dire 200-720 mV, le ferrocene est oxydé, et transfère un
seul électron à l'électrode par l'intermédiaire de l'oligomère
conducteur. Cependant, l'ETM est incapable d'accepter tout
30 électron de la source d'électron luminol, comme les voltages
sont inférieurs au potentiel redox du luminol. Cependant, au
potentiel redox du luminol ou au-dessus, le luminol transfère
alors un électron à 1'ETM, permettant un transfert
électronique plus rapide et répété. De cette manière, la
35 source électronique (ou co-réducteur) sert à amplifier le
signal généré dans le système, comme les molécules de la177
source d'électron donnent rapidement et de manière répétée des
électrons à l'ETM de la sonde de marquage.
Le luminol a le bénéfice en plus de devenir une espèce à
5 chimiluminescence sur l'oxydation (voir Jirka et al.,
Analytica Chimica Acta 284:385 (1993)), permettant ainsi la
photodétection d'un transfert d'électron de 1'ETM à
l'électrode. Ainsi, tant que. le luminol est. incapable -d'entrer-
en contact directement avec l'électrode, c'est-à-dire en
10 présence de la SAM de manière à ce qu'il n'y ait aucun chemin
de transfert électronique efficace jusqu'à l'électrode, le
luminol peut seulement être oxydé en transférant un électrode
à l'ETM sur la sonde de marquage. Quand l'ETM n'est pas
présente, c'est-à-dire quand la séquence cible n'est pas
15 hybridée à la composition de l'invention, le luminol n'est pas
oxydé de manière significative, ce qui résulte en une faible
émission de photon et ainsi un faible signal (s'il existe)
depuis le luminol. En présence de la cible, un signal bien
plus important est généré. Ainsi, la mesure d'oxydation du
20 luminol par émission de photon est une mesure indirecte de la
capacité de l'ETM à donner des électrons à l'électrode. Ainsi,
comme la détection de photon est généralement plus sensible
que la détection électronique, la sensibilité du système peut
être augmentée. Des résultats initiaux suggèrent que la
25 luminescence peut dépendre de la concentration en peroxyde
d'hydrogène, du pH, et de la concentration en luminol, cette
dernière apparaissant comme non linéaire.
Des molécules de source d'électron convenables sont bien
30 connues dans la technique, et comprennent, mais sans s ' y
limiter, le ferrocyanide, et le luminol.
En variante, des accepteurs ou des puits d'électrons sortant
peuvent être utilisés, c'est-à-dire que les réactions ci-
35 dessus peuvent fonctionner à 1'inverse, 1'ETM comme un
métallocène recevant un électron de l'électrode, le
transformant en métallicénium, l'accepteur d'électron sortant178
acceptant alors 1'électron rapidement et de manière répétée.
Dans ce mode de réalisation, le cobalticénium est l'ETM
préférée.
5 La présence des ETM'à la surface d'une couche monomoléculaire
peut être détectée par une variété de moyens. Une variété de
procédés de détection peut être utilisée, y compris, mais sans
s'y limiter, la détection _optique (comme le résultat des
changements spectraux sur les changements des états redox) qui
10 comprend la fluorescence, la phosphorescence, la luminescence,
la chimioluminescence, 1'électrochimioluminescence, et
1'indice de réfraction ; et la détection électronique, y
compris mais sans s'y limiter, 1'ampérométrie, la voltamétrie,
la capacitance et l'impédance. Ces procédés comprennent des
15 procédés qui dépendent de la fréquence ou du temps basés sur
des courants AC ou DC, des procédés puisés, des techniques de
verrouillage, du filtrage (passe-haut, passe-bas, bande
passante) , et techniques de temps résolu y compris la
fluorescence en temps résolu.
20
Dans un mode de réalisation, le transfert d'électrons efficace
de 1'ETM à 1'électrode résulte dans les changements
stéréotypés dans l'état redox de l'ETM. Avec de nombreuses ETM
y compris les complexes de ruthénium contenant les anneaux de
25 bipyridine, pyridine et imidazole, ces changements dans l'état
redox sont associés à des changements dans les propriétés
spectrales. Des différences significatives en absorbance sont
observées entre les états réduits et oxydés pour ces
molécules. Voir par exemple Fabbrizzi et al., Chem. Soc. Rev.
30 1995 pages 197 à 202). Ces différences peuvent être
surveillées en utilisant un spectrophotomètre ou un système
simple de tubes photomultiplicateurs.
Dans ce mode de réalisation, des donneurs et des accepteurs
35 d'électrons possibles comprennent tous les dérivés listés ci-
dessus pour la photoactivation ou 1'initiation. Des donneurs
et des accepteurs d'électrons préférés ont de manière179
caractéristique de gros changements spectraux sur 1'oxydation
et la réduction qui ont pour résultat la surveillance
hautement sensible du transfert électronique. De tels exemples
comprennent Ru (NH3) 4py et Ru (bpy) 2-im en tant qu 'exemples
5 préférés. Il doit' être compris que seul le donneur ou
l'accepteur qui est surveillé par absorbance nécessite des
caractéristiques spectrales idéales.
Dans un mode de réalisation préféré, le transfert électronique
10 est détecté par fluorométrie. De nombreux complexes de métal
de transition, y compris ceux du ruthénium, ont des propriétés
de fluorescence distinctes. Par conséquent, le changement dans
l'état redox des donneurs d'électrons et des accepteurs
d'électrons liés à l'acide nucléique peut être surveillé de
15 manière très sensible en utilisant la fluorescence, par
exemple Ru(4,7-biphényl2-phénanthroline)32+. La production de
ce composé peut être facilement mesurée en utilisant les
techniques de dosage de fluorescence standard. Par exemple la
fluorescence excitée par laser peut être enregistrée du
20 fluoromètre standard à simple cellule, un flux au travers, du
fluoromètre "en ligne" (comme ceux liés à un système de
Chromatographie) ou un "lecteur de lame" multi-échantillons
similaire à ceux commercialisés pour les dosages immuno
à 96 puits.
25
En variante, la fluorescence peut être mesurée en utilisant
des capteurs de fibres optiques avec des sondes d'acide
nucléique en solution ou liées à la fibre optique. La
fluorescence est surveillée en utilisant un tube
30 photomultiplicateur ou un autre instrument de détection léger
lié à la fibre optique. L'avantage de ce système est qu'on
peut doser des volumes d'échantillons extrêmement petits.
En outre, des détecteurs de fluorescence à balayage comme le
35 Fluorimager vendu par Molecula Dynamics sont idéaux pour la
surveillance de la fluorescence des molécules d'acide
nucléique modifié déployées sur des surfaces solides.180
L'avantage de ce système est le grand nombre de sondes de
transfert électronique qui peuvent être examinées à la fois en
utilisant des puces couvertes de milliers de sondes d'acide
nucléique distinctes.
5
De nombreux complexes de métal de transition montrent une
fluorescence avec d'importants décalages de Stokes. Des
exemples convenables comprennent les complexes bis- et
trisphénanthroline et des complexes bis- et trisbipyridyle de
10 métaux de transition comme le ruthénium (voir Juris, A.,
Balzani, V., et al. Coord. Chem. Rev. V. 84 P; 85-277, 1988).
Des exemples préférés montrent une fluorescence efficace
(rendements de quantum raisonnablement élevés) comme des
énergies de réorganisation faibles. Ceci inclut
15 Ru(4,7-biphényl2-phénanthhroline)32\ Ru (4, 4-diphényl-2, 2 *-
bipyridine) 32+ et des complexes de platine (voir Cummings et
al., J. Am. Chem. Soc. 118:1949-1960 (1996). En variante, une
réduction de fluorescence associée à une hybridation peut être
mesurée en utilisant ces systèmes.
20
Dans un autre mode de réalisation, 1'électrochimioluminescence
est utilisée comme la base de la détection du transfert
d'électron. Avec certaines ETM comme Ru2+(bpy)3, une
luminescence directe accompagne le déclin de l'état excité.
25 Des changements dans cette propriété sont associés à
l'hybridation de l'acide nucléique et peuvent être surveillés
avec une simple disposition de tubes photomultiplicateurs
(voir Blackburn, G. F. Chem. 37:1534-1539 (1991) ; et Juris et
al., supra).
30
Dans un mode de réalisation préféré, la détection électronique
est utilisée, y compris 1'ampérométrie, la voltamétrie, la
capacitance et l'impédance. Des techniques convenables
comprennent, mais sans s'y limiter, 1'électrogravimétrie, la
35 coulométrie (y compris la coulométrie à potentiel contrôlé et
la coulométrie à courant constant) ; la voltamétrie
(voltamétrie cyclique, voltamétrie puisée, voltamétrie à onde181
carrée, voltamétrie puisée différentielle, voltamétrie à onde
carrée d'Osteryoung et techniques puisées coulostatiques) ;
analyse de stripping (analyse de stripping aniodique, analyse
de stripping cathiodique, voltamétrie de stripping à onde
5 carrée) ; mesure dé conductance (conductance électrolytique,
analyse directe) ; analyses électrochimiques dépendant du
temps (chronoampérométrie, ehronopotentiométrie,
chronopotentiométrie cyclique ?_ et ampérométrie - cyclique,
polographie AC, chronogalvamétrie, et chronocolorimétrie) ;
10 mesure de l'impédance AC ; mesure de la capacitance ;
voltamétrie AC ; et photoélectrochimie-.
Dans un mode de réalisation préféré, la surveillance du
transfert électronique se fait par l'intermédiaire de
15 détection ampérométrique. Ce procédé de détection implique
l'application d'un potentiel (comme comparé à une électrode de
référence séparée) entre l'électrode d'acide nucléique
conjugué et une électrode de référence (auxiliaire) dans
l'échantillon contenant les gènes cibles d'intérêt. Le
20 transfert d'électron d'efficacités différentes est induit dans
des échantillons en présence ou en l'absence d'acide
nucléique ; c'est-à-dire que la présence ou l'absence d'acide
nucléique, et par conséquent de la sonde de marquage, peut
résulter en différents courants.
25
Le système pour mesurer le transfert d'électron
ampérométriquement impliqué une détection de courant sensible
et comprend un moyen de contrôler le potentiel de voltage,
habituellement un potentiostat. Ce voltage est optimisé en
30 référence au potentiel du complexe donnant des électrons sur
la sonde de marquage. De complexes donnant des électrons
possibles comprennent ceux mentionnés au préalable avec les
complexes de fer, osmium, platine, cobalt, rhénium et
ruthénium étant préférés et les complexes de fer étant
35 préférés entre tous.182
Dans un mode de réalisation préféré, des modes de détection
électroniques alternatifs sont utilisés. Par exemple, des
mesures potentiométriques (ou voltamétrique) impliquent des
processus non faradiques (pas de circulation de courant net)
5 et sont utilisées traditionnellement dans le pH et d'autres
détecteurs d'ions. Des capteurs similaires sont utilisés pour
surveiller le transfert électronique entre l'ETM et
l'électrode. En outre, d'autres propriétés d'isolateurs (comme
la résistance) et de conducteurs (comme la conductivité,
10 1'impédance et la capacitance) peuvent être utilisées pour
surveiller le transfert d'électron entre l'ETM et l'électrode.
Finalement, tout système qui génère un courant (comme un
transfert d'électron) génère aussi un petit champ magnétique,
qui peut être surveillé dans certains modes de réalisation.
15
Il doit être compris que l'un des bénéfices des taux de
transfert d'électron rapide observés dans les compositions de
l'invention est que la résolution temporelle peut grandement
améliorer les résultats signal/bruit des moniteurs basés sur
20 l'absorbance, la fluorescence et le courant électronique. Les
taux de transfert d'électron rapides de la présente invention
résultent à la fois en des hauts signaux et des retards
stéréotypés entre l'initiation du transfert d'électrons et son
achèvement. Par l'amplification de signaux de retards
25 particuliers, de manière à ce qu'au travers de l'utilisation
de 1'initiation puisée du transfert d'électron et des
amplificateurs "de verrouillage de détection", et les
transformées de Fourier.
30 Dans un mode de réalisation préféré, le transfert d'électron
est initié en utilisant des procédés de courant alternatif
(AC) . Sans être liées par théorie, il apparaît que les ETM,
liées à une électrode, répondent généralement de manière
similaire à un voltage AC à travers un circuit contenant des
35 résistances et des condensateurs. Fondamentalement, tout
procédé -qui permet la détermination de la nature de ces
complexes, qui agissent comme une résistance et un183
condensateur, peut être utilisé comme la base de détection. De
manière surprenante, la théorie électrochimique
traditionnelle, comme illustré dans Laviron et al., J.
Electroanal. Chem. 97:135(1979) et Laviron et al., J.
5 Electroanal. Chem. 105:35 (1979), ne modélise pas précisément
les systèmes décrits ici, excepté pour de très petits EAC
(moins de 10 mV) et de relativement grands nombres de
molécules._ C'est-à-dire . que. le courant AC (I) n'est pas
précisément décrit par l'équation de Laviron. Ceci peut être
10 dû en partie au fait que cette théorie suppose une source
illimitée et un puits illimité d'électrons, ce qui n'est pas
vrai dans les présents systèmes.
La théorie de la voltamétrie AC qui modélise bien ce système
15 est expliquée dans O'Connor et al., J. Electroanal. Chem.
466(2) : 197-202 (1999), incorporé ici expressément à titre de
référence. L'équation qui prédit ces systèmes est montrée ci-
dessous dans l'équation 1 :
20 Equation 1
'*u-=2n/F/Vte/.-----------------üi-----------------
tvs *** nF r. ,____r/ï/=
cosh[? -E^J^ooshl?{E0C~B0)\
Dans l'équation 1, n est le nombre d'électrons oxydés ou
réduits par la molécule redox, f est la fréquence appliquée, F
est la constante de Faraday, Ntotai est le nombre total de
25 molécules redox, E0 est le potentiel officiel de la molécule
redox, R est la constante de gaz, T est la température en
degré Kelvin, et Eoc est le potentiel de l'électrode. Le modèle
correspond très bien aux données expérimentales. Dans certains
cas, le courant est inférieur à celui prédit, cependant, on a
30 montré que ceci est dû à la dégradation de ferrocene à
laquelle on peut remédier de nombreuses manières différentes.
De plus, le courant faradique peut aussi être exprimé en
fonction du temps, comme montré dans l'équation 2 :184
Equation 2
,,»,.------!i___:-------iLiü
'21 f (coshf-fi-C/ (t)-_0) ]+i)
K 7
5 If est le courant faradique et qo est la charge élémentaire.
Cependant,' 1'équation 1 n'incorpore pas 1'effet du taux de
transfert d'électron ni les facteurs instrumentaux. Le taux de
transfert d'électron est important quand le taux est proche ou
10 inférieur à la fréquence appliquée. Ainsi, le véritable iAc
doit être une fonction des trois, comme représenté dans
1'équation 3.
Equation 3
15 iÄC = f (facteurs Nernst) f (Ket) (facteurs instrumentaux)
Ces équations peuvent être utilisées pour modéliser et prédire
les courants AC attendus dans les systèmes qui utilisent des
signaux entrants comprenant à la fois des composants AC et DC.
20 Comme expliqué ci-dessus il est surprenant de voir que la
théorie traditionnelle ne modélise absolument pas ce système,
sauf pour des voltages très bas.
En général, les sondes de marquage fixées non
25 spécifiquement/ETM montrent des différences en impédance
(c'est-à-dire des impédances plus élevées) que lorsque les
sondes de marquage contenant les ETM sont fixées
spécifiquement dans l'orientation correcte. Dans un mode de
réalisation préféré, le matériau fixé est spécifiquement
30 enlevé par lavage, ce qui a pour résultat une impédance
effective égale à l'infini. Ainsi, la détection AC donne de
nombreux avantages comme généralement discuté ci-dessous, y
compris une augmentation de la sensibilité, et la capacité de
filtrer - vers l'extérieur le bruit en arrière-plan. En
35 particulier, les changements en impédance (y compris par185
exemple, l'impédance de masse) comme entre la fixation non
spécifique de sonde contenant des ETM et la formation complexe
de dosage spécifique d'une cible peuvent être surveillés.
5 En conséquence, quand on utilise des procédés d'initiation et
de détection AC, la réponse de fréquence du système change
comme le résultat de la présence des ETM. Par "réponse de
fréquence" on entend ici une modification des signaux comme
résultat du transfert d'électron entre l'électrode et l'ETM.
10 Cette modification est différente selon la fréquence du
signal. Une réponse de fréquence comprend des courants AC à
une ou plusieurs fréquences, des changements de phase, des
voltages de compensation DC, l'impédance faradique, etc.
15 Une fois que le complexe de dosage y compris la séquence cible
et la sonde de marquage est fait, un premier signal électrique
entrant est alors appliqué au système, de préférence par
1'intermédiaire d'au moins 1'électrode d'échantillon
(contenant les complexes de l'invention), et l'électrode
20 auxiliaire, pour initier le transfert d'électron entre
l'électrode et l'ETM. Trois systèmes d'électrodes peuvent
aussi être utilisés. Avec le voltage appliqué aux électrodes
de référence et à étudier. Le premier signal entrant comprend
au moins un composant AC. Le composant AC peut être d'une
25 amplitude et d'une fréquence variable. Généralement, pour
1'utilisation des présents procédés, 1'amplitude AC va
d'environ 1 mV à environ 1,1 V, d'environ 10 mV à environ 800
mV étant préféré, et d'environ 10 mV à environ 50 mV étant
spécialement préféré. La fréquence AC va d'environ 0,01 Hz à
30 environ 100 MHz, d'environ 10 Hz à environ MHz étant préférée
et d'environ 100 Hz à environ 20 MHV étant spécialement
préférée.
L'utilisation de combinaisons de signaux AC et DC donne une
35 variété d'avantages, y compris une sensibilité et une
maximisation du signal surprenantes.186
Dans un mode de réalisation préféré, le premier signal entrant
comprend un composant DC et un composant AC. C'est-à-dire un
voltage de compensation DC entre les électrodes d'échantillons
et auxiliaires est balayé à travers le potentiel
5 électrochimique de l'ETM (par exemple, quand le ferrocene est
utilisé, le balayage est généralement de 0 à 500 mV) (ou
alternativement, l'électrode à étudier est mise à la terre et
l'électrode de référence est balayée- -de - 0 "à -500 " mV) . Le
balayage e'st utilisé pour identifier le voltage DC auquel on
10 voit la réponse maximum du système. Ceci est généralement au
niveau ou environ au niveau du potentiel électrochimique de
l'ETM. Une fois que ce voltage est déterminé, on peut utiliser
soit un balayage soit un ou plusieurs voltages de compensation
DC uniforme. Les voltages de compensation DC d'environ -1 V à
15 environ +1,IV sont préférés, d'environ -500 mV à environ +800
mV étant spécialement préférés et d'environ -300 mV à environ
500 mV étant particulièrement préférés. Dans un mode de
réalisation préféré, le voltage de compensation DC n'est pas
zéro. En plus du voltage de compensation DC, un composant de
20 signal AC d'amplitude et de fréquence variables est appliqué.
Si l'ETM est présente, et peut répondre à la perturbation AC,
un courant AC va être produit dû au transfert d'électron entre
l'électrode et l'ETM.
25 Pour des systèmes définis, il peut être suffisant d'appliquer
un seul signal entrant pour faire la différenciation entre la
présence et l'absence de l'acide nucléique de l'ETM (c'est-à-
dire la présence de la séquence cible) .En variante, une
pluralité de signaux entrant est appliquée. Comme expliqué
30 ici, ceci peut prendre une variété de formes, y compris en
utilisant des fréquences multiples, des voltages de
compensation DC multiples, ou des amplitudes AC multiples, ou
des combinaisons de tous ou de n'importe lequel de ceux-ci.
35 Ainsi, dans un mode de réalisation préféré, des voltages de
compensation DC multiples sont utilisés, bien que comme
expliqué ici, des balayages de voltages DC sont préférés. Ceci187
peut être fait à fréquence simple, ou à deux fréquences ou
plus.
Dans un mode de réalisation préféré, l'amplitude AC est
5 variée. Sans être ' liée par la théorie, il apparaît que
l'augmentation de l'amplitude augmente la force moteur. Ainsi,
des amplitudes plus élevées, qui ont pour résultat des
surtensions plus importantes, - donnent des taux de référence
d'électrons plus rapides. Ainsi, généralement, le même système
10 donne une réponse améliorée (c'est-à-dire des signaux sortant
supérieurs) à n'importe quelle fréquence simple par
1'utilisation de surtensions supérieures à cette fréquence.
Ainsi, l'amplitude peut être augmentée à une fréquence élevée
pour augmenter le taux de transfert d'électron dans le
15 système, avec pour résultat une meilleure sensibilité. En
outre, ceci peut être utilisé, par exemple, pour induire des
réponses dans des systèmes plus lents comme ceux qui ne
possèdent pas de configuration d'espacement optimale.
20 Dans un mode de réalisation préféré, des mesures du système
sont prises à au moins deux amplitudes ou surtensions
séparées, des mesures prises à une pluralité d'amplitudes
étant préférées. Comme noté ci-dessus, des changements dans la
réponse comme résultat des changements dans l'amplitude
25 peuvent former la base de l'identification, de la calibration
et de la quantification du système. En outre, une ou plusieurs
fréquences AC peuvent être aussi utilisées.
Dans un mode de réalisation préféré, la fréquence AC est
30 variée. A différentes fréquences, différentes molécules
répondent de différentes manières. Comme l'appréciera l'homme
du métier, l'augmentation de la fréquence augmente
généralement le courant sortant. Cependant, quand la fréquence
est meilleure que le taux auquel les électrons peuvent voyager
35 entre l'électrode et l'ETM, des fréquences supérieures ont
pour résultat une perte ou une baisse du signal sortant. A
certains points, la fréquence va être meilleure que le taux detransfert d'électron entre l'ETM et l'électrode, et le signal
sortant va alors aussi chuter.
Dans un mode de réalisation, la détection utilise une seule
5 mesure de signal so'rtant à une seule fréquence. C'est-à-dire
que la réponse de la fréquence du système en l'absence de
séquence sonde, et ainsi l'absence de sonde de marquage
contenant des ETM, ..peut, être -préalablement déterminée pour
être très' basse à une fréquence élevée particulière. En
10 utilisant cette information, toute réponse à une fréquence
particulière, va montrer la présence du complexe de dosage.
C'est-à-dire que toute réponse à une fréquence particulière
est caractéristique du complexe de dosage. Ainsi, il peut être
seulement nécessaire d'utiliser une seule autre fréquence
15 d'entrée, et tout changement dans la réponse de la fréquence
est une indication que l'ETM est présente, et ainsi que la
séquence cible est présente.
En outre, l'utilisation des techniques AC permet la réduction
20 significative de signaux d'arrière-plan à n'importe quelle
fréquence à cause des entités autres que les ETM, c'est-à-dire
des signaux "enfermés à 1'extérieur" ou "filtrants" non
désirés. C'est-à-dire que la réponse de la fréquence d'un
transporteur de charges ou d'une molécule active redox en
25 solution va être limitée par son coefficient de diffusion et
son coefficient de transfert de charge. En conséquence, à des
fréquences élevées, un transporteur de charges peut ne pas
diffuser assez rapidement pour transférer sa charge à
l'électrode, et/ou la cinétique de transfert de la charge peut
30 ne pas être assez rapide. Ceci est particulièrement
significatif dans les modes de réalisation qui n'ont pas de
bonne couche monomoléculaire, c'est-à-dire qui ont des couches
monomoléculaires partielles ou insuffisantes, c'est-à-dire où
le solvant est accessible à l'électrode. Comme expliqué ci-
35 dessous, dans les techniques DC, la présence de "trous" où
l'électrode est accessible au solvant peut résulter dans le
"court-circuitage" du système par les transporteurs de charge189
du solvant, c'est-à-dire qu'ils atteignent l'électrode et
génèrent un signal d'arrière-plan. Cependant, en utilisant les
présentes techniques AC, une ou plusieurs fréquences peut être
choisie qui va empêcher une réponse de fréquence d'un ou
5 plusieurs des transporteurs de charges en solution, que la
couche monomoléculaire soit présente ou pas. Ceci est
particulièrement significatif pour de nombreux fluides
biologiques comme . le sang ..qui contiennent-- des quantités
significatives de molécules actives redox qui peuvent
10 interférer avec les procédés de détection ampérométriques.
Dans un mode de réalisation préféré, des mesures du système
sont prises à au moins deux fréquences séparées, des mesures
prises à une pluralité de fréquences étant préférées. Une
15 pluralité de fréquences comprend un balayage. Par exemple, la
mesure du signal sortant, par exemple le courant AC, à une
faible fréquence d'entrée comme 1-20 Hz, et la comparaison de
la réponse au signal sortant à haute fréquence comme 10-100
kHz va montrer une différence de réponse de fréquence entre la
20 présence et l'absence de l'ETM. Dans un mode de réalisation
préféré, la réponse de fréquence est déterminée à au moins
deux, de manière préférée à au moins cinq, et de manière
davantage préférée à au moins dix fréquences.
25 Après la transmission du signal entrant pour initier le
transfert d'électron, un signal sortant est reçu ou détecté.
La présence et l'ampleur du signal entrant va dépendre d'un
certain nombre de facteurs, y compris la tension/amplitude du
signal entrant ; la fréquence du signal AC entrant ; la
30 composition du moyen d'intervention ; la compensation DC ;
l'environnement du système ; la nature de l'ETM ; le solvant ;
et le type et la concentration de sel. A un signal entrant
donné, la présence et l'amplitude du signal sortant vont
dépendre en général de la présence ou de l'absence de l'ETM,
35 du placement et de la distance de l'ETM à la surface de la
couche monomoléculaire et du caractère du signal entrant. Dans
certains modes de réalisation, il peut être possible de faire190
la distinction entre la fixation non spécifique de sonde de
marquage et la formation de complexes de dosage spécifiques à
la cible contenant les sondes de marquage, sur la base de
1'impédance.
5
Dans un mode de réalisation préféré, le signal sortant
comprend un courant AC. Comme expliqué ci-dessus, l'amplitude
du signal sortant. ya_ dépendre, d'un---certain nombre de"
paramètres'. En faisant varier ces paramètres, le système peut
10 être optimisé par un certain nombre de moyens différents.
En général, les courants AC générés dans la présente invention
vont d'environ 1 femptoamp. à environ 1 milliamp., des
courants d'environ 50 femptoamp. à environ 100 microamp. étant
15 préférés, et d'environ 1 picoamp. à environ 1 microamp. étant
spécialement préférés.
Dans un mode de réalisation préféré, le signal sortant est
déphasé dans le composant AC par rapport au signal entrant.
20 Tant que ce ne soit lié à la théorie, il apparaît que les
systèmes de la présente invention peuvent être suffisamment
uniformes pour permettre une détection basée sur le déphasage.
C'est-à-dire que les biomolécules complexes de l'invention au
travers desquelles le transfert électronique a lieu réagissent
25 à l'entrée AC d'une manière homogène, similaire aux composants
électroniques standard, de manière à ce qu'un déphasage puisse
être déterminé. Ceci peut servir de base de détection à la
présence et l'absence de l'ETM, et/ou les différences entre la
présence de complexes de dosage spécifiques à la cible
30 comprenant des sondes de marquage et de fixation non
spécifiques des sondes de marquage des composants du système.
Le signal sortant est caractéristique de la présence de
l'ETM ; c'est-à-dire que le signal sortant est caractéristique
35 de la présence du complexe de dosage spécifique à la cible
comprenant des sondes de marquage et des ETM. Dans un mode de
réalisation préféré, la base de la détection est une191
différence entre 1'impédance faradique du système comme
résultat de la formation du complexe de dosage. L'impédance
faradique est l'impédance du système entre l'électrode et
l'ETM. L'impédance faradique est assez différente de
5 1'impédance diélectrique ou interne, qui est 1'impédance de la
solution totale entre les électrodes. Beaucoup de facteurs
peuvent changer l'impédance faradique qui peuvent ne pas
affecter l'impédance -interne,- et vice-et-versä." Ainsi, les
complexes 'de dosage comprenant les acides nucléiques dans ce
10 système ont une certaine impédance faradique, qui va dépendre
de la distance entre l'ETM et l'électrode, de leurs propriétés
électroniques, et de la composition du moyen d'intervention
entre autres choses. Dans ces procédés de l'invention, ce qui
est important est que l'impédance faradique entre l'ETM et
15 l'électrode est significativement différente selon si les
sondes de marquage contenant les ETM sont spécifiquement ou
non spécifiquement fixées à l'électrode.
En conséquence, la présente invention fournit en plus des
20 systèmes ou des appareils électroniques pour la détection des
analytes cibles utilisant les compositions de l'invention.
L'appareil comprend une chambre de test pour la réception
d'une solution échantillon qui a au moins une première
électrode de mesure ou échantillon, et une seconde électrode
25 de mesure ou auxiliaire. Les systèmes à trois électrodes sont
aussi utiles. La première et la seconde électrode de mesure
sont en contact avec une région recevant l'échantillon test,
de manière à ce qu'en présence d'un échantillon test liquide,
les deux électrodes d'électrophorèse puissent être en contact
30 électrique.
Dans un mode de réalisation préféré, l'appareil comprend aussi
des électrodes de détection comprenant une seule sonde de
capture d'acide nucléique simple brin liée de manière
35 covalente à un lieur de liaison, et une couche monomoléculaire
comprenant des oligomères conducteurs, comme décrit ici.192
L'appareil comprend en plus une source de voltage AC
électriquement connectée à la chambre test ; c'est-à-dire aux
électrodes de mesure. De préférence, la source de voltage AC
est aussi capable de délivrer du voltage de compensation DC.
5
Dans un mode de réalisation préféré, l'appareil comprend aussi
un processeur capable de comparer le signal entrant et le
signal sortant. Le .processeur .est-couplé- aux - électrodes- - et
configuré pour recevoir un signal sortant, et ainsi détecter
10 la présence de l'acide nucléique.
Ainsi, les compositions de la présente invention peuvent être
utilisées dans une variété de contrôle de travaux, de contrôle
clinique et de contrôle qualité, ou de réglages de tests sur
15 place.
Dans un mode de réalisation préféré, les sondes sont utilisées
dans le diagnostic génétique. Par exemple, les sondes peuvent
être faites en utilisant les techniques décrites ici pour
20 détecter des séquences cibles comme le gène pour le cancer du
colon non polypeux, le gène du cancer du sein BRCA1, P53, qui
est un gène associé à une variété de cancers, le gène Apo E4
qui indique un risque plus important de maladie d'Alzheimer,
permettant un dépistage facile pré-symptomatique des patients,
25 des mutations dans le gène de la fibrose cystique, ou tout
autre bien connu dans la technique.
Dans un mode de réalisation supplémentaire, la détection
virale et bactérienne est faite en utilisant les complexes de
30 l'invention. Dans ce mode de réalisation, les sondes sont
conçues pour détecter des séquences cibles parmi une variété
de bactéries et de virus. Par exemple, des techniques
actuelles du criblage du sang reposent sur la détection des
anticorps anti VIH. Les procédés décrits ici permettent un
35 criblage direct des échantillons cliniques pour détecter les
séquences d'acide nucléique VIH, en particulier les séquences
VIH hautement conservées. En outre, ceci permet une193
surveillance directe du virus circulant dans un patient sur la
forme d'un procédé amélioré de suppositions de l'efficacité
des thérapies anti virales. De manière similaire, les virus
associés à la leucémie, HTLV-I et HTLV-II, peuvent être
5 détectés de cette manière. Les infections bactériennes comme
la tuberculose, la chlamydiose et d'autres maladies
sexuellement transmissibles, peuvent aussi être détectées.
Dans un mode de réalisation préféré, les acides nucléiques de
10 l'invention trouvent une utilisation comme sondes pour les
bactéries toxiques dans le criblage de l'eau et les
échantillons alimentaires. Par exemple, les échantillons
peuvent être traités pour lyser la bactérie pour libérer son
acide nucléique, et ainsi les sondes conçues pour reconnaître
15 les souches bactériennes, y compris, mais sans s ' y limiter,
les souches pathogènes comme Salmonella, Campylobacter, Vibrio
cholerae, Leishmania, les souches entérotoxiques comme E.
Coli, et les bactéries de la maladie du Légionnaire. De
manière similaire, des stratégies de bioréparation peuvent
20 être évaluées en utilisant les compositions de l'invention.
Dans un autre mode de réalisation, les sondes sont utilisées
pour les méthodes "d'empreintes génétiques" médico-légales
pour associer 1'ADN retrouvé sur la scène du crime à des
25 échantillons pris sur les victimes et les suspects.
Dans un mode de réalisation supplémentaire, les sondes dans
une gamme sont utilisées pour le séquençage par hybridation.
30 Ainsi, la présente invention fournit pour des sondes
extrêmement spécifiques et sensibles, qui peuvent, dans
certains modes de réalisation, détecter des séquences cibles
sans enlever les sondes non hybridées. Ceci peut être utile
dans la génération de dosage de sondes de gènes automatisés.
35
En variante, les compositions de l'invention sont utiles pour
détecter l'amplification réussie de gènes dans le PCR,194
permettant ainsi aux réactions PCR réussies d'être une
indication de la présence ou de l'absence d'une séquence
cible. Le PCR peut être ainsi utilisée de plusieurs manières
différentes. Par exemple, dans un mode de réalisation, la
5 réaction PCR est faite comme il est connu dans la technique,
puis ajoutée à une composition de l'invention comprenant
l'acide nucléique avec une ETM, liée de manière covalente à
une électrode par l'intermédiaire d'un oligomère conducteur
avec détection ultérieure de la séquence cible. En variante,
10 le PCR est fait en utilisant des nucleotides marqués avec une
ETM, soit en présence d'une électrode, soit par addition
ultérieure de celle-ci, avec un oligomère conducteur et un
acide nucléique cible. La fixation du produit PCR contenant
les ETM à la composition de l'électrode va permettre la
15 détection par l'intermédiaire du transfert électronique.
Finalement, l'acide nucléique lié à l'électrode par
l'intermédiaire d'un polymère conducteur peut être une amorce
PCR, avec ajout d'une seconde amorce marquée avec une ETM.
L'élongation a pour résultat un acide nucléique double brin
20 avec une ETM et une électrode liées de manière covalente. De
cette manière, la présente invention est utilisée pour la
détection PCR de séquences cibles.
Dans un mode de réalisation préféré, les gammes sont utilisées
25 pour la détection d'ARNm. Un mode de réalisation préféré
utilise soit des sondes de capture soit des sondes succédanées
de capture qui s'hybrident près de la queue 3' de
polyadénylation des ARNm. Ceci permet l'utilisation d'une
espèce de sonde de fixation cible pour la détection, c'est-à-
30 dire que la sonde contient une partie poly-T qui va se fixer à
une queue poly-A de la cible d'ARNm. Généralement, la sonde va
contenir une seconde partie, de préférence non poly-T, qui va
se fixer à la sonde de détection (ou à une autre sonde) . Ceci
permet la création d'une sonde de fixation cible, et réduit
35 ainsi la quantité de synthèses de sondes différentes
effectuées.195
Dans un mode de réalisation préféré, l'utilisation d'enzymes
de restriction et de procédés de ligation permet la création
de gammes "universelles". Dans ce mode de réalisation, les
couches monomoléculaires comprenant des sondes de capture qui
5 comprennent des extrémités d'endonucléase de restriction,
comme généralement représenté sur la figure 6. En utilisant
des parties complémentaires d'acide nucléique, tout en
laissant les "extrémités adhérentes", une gamme comprenant "un
certain nombre de sites d'endonucléases de restriction est
10 créée. Le traitement d'un échantillon cible avec une ou
plusieurs de ces endonucléases de restriction permet aux
cibles de se fixer à la gamme. Ceci peut être effectué sans
connaître la séquence de la cible. Les séquences cibles
peuvent être ligaturées, si souhaitées, en utilisant des
15 procédés standard comme des ligases, et la séquence cible
détectée, en utilisant soit des marquages standard soit les
méthodes de l'invention.
La présente invention fournit des procédés qui peuvent avoir
20 pour résultat la détection sensible des acides nucléiques.
Dans un mode de réalisation préféré, moins d'environ 10 x IO6
molécules sont détectées, moins d'environ 10 x 105 étant
préférées, moins de 10 x 10*5 étant particulièrement préférées,
moins d'environ 10 x 103 étant spécialement préférées, et
25 moins d'environ 10 x IO2 étant préférées entre toutes. Comme
l'appréciera l'homme du métier, ceci suppose une corrélation
1:1 entre les séquences cibles et les molécules rapporteuses ;
si plus d'une molécule rapporteuse (c'est-à-dire de groupes
caractéristiques de transfert électronique) est utilisée pour
30 chaque séquence cible, la sensibilité va augmenter.
Alors que les limites de détection sont actuellement évaluées,
basées sur le taux de transfert d'électron publié au travers
de l'ADN, qui est à peu près de 1 x IO6 électrons/sec/duplex
35 pour une séparation de 8 paires de bases (voir Meade et al.,
Angw. Chem, Eng. Ed., 34:352 (1995)) et des forces moteur
importantes, des fréquences AC d'environ 100 kHz doivent être196
possibles. Comme les résultats préliminaires le montrent, le
transfert électronique par ces systèmes est assez efficace,
résultant dans près de 100 x IO3 électrons/sec, qui a pour
résultat une sensibilité potentielle en femptoamp. pour très
5 peu de molécules.
*
Toutes les références citées ici sont incorporées à titre de
référence dans leur intégralité.. . .-
10 EXEMPLES
Exemple 1
Procédés généraux pour créer des substrats et des couches
monomoléculaires
15 Formation de SAM sur des substrats-procédures générales
Les couches monomoléculaires auto-assemblées ont été formées
sur une surface en or propre. La surface en or peut être
préparée selon une variété de procédés différents : fil d'or
fondu ou poli, or évaporé ou crachoté sur des tranches de
20 verre ou de mica ou de silicium ou d'autres substrats, de l'or
en dépôt électrolytique ou dépôt auto-catalytique sur du
matériau de carte à circuit imprimé ou du verre ou du silicium
ou d'autres substrats. Tant les échantillons d'or déposés sous
vide (évaporés et crachotes) que les échantillons d'or déposés
25 en solution (dépôt auto-catalytique et dépôt électrolytique)
requièrent souvent 1'utilisation d'une couche d'adhésion entre
le substrat et 1'or afin d'assurer une bonne stabilité
mécanique. Le chrome, le titane, le titane/tungstène ou le
tantale sont fréquemment employés avec l'or crachoté et
30 évaporé. Le nickel par dépôt électrolytique est habituellement
employé avec l'or en dépôt électrolytique et en dépôt
autocatalytique, cependant d'autres métaux d'adhésion peuvent
être utilisés.
35 Le substrat en or est nettoyé avant la formation de la couche
monomoléculaire. Une variété de procédures différentes ont été
employées. Le nettoyage avec une solution chimique est la197
procédure la plus répandue. La solution Piranha (peroxyde
d'hydrogène/acide sulfurique) ou nettoyage par eau régale
(acide chlorhydrique/acide nitrique) est la plus répandue,
cependant des procédés électrochimiques, le traitement par
5 flammes et les procé'dés de plasma ont aussi été employés.
A la suite du nettoyage, le substrat en or est incubé dans une
solution de déposition. La .solution-de-déposition est-composée
d'un mélan'ge de thiols différents dans un solvant. Un mélange
10 de thiols alcane dans un solvant organique comme l'éthanol est
la procédure la plus répandue, cependant de nombreuses
variations ont été développées. Des procédures alternatives
impliquent la déposition en phase gazeuse du thiol alcane,
l'impression par microcontact, la déposition utilisant un
15 thiol pur, la déposition depuis un solvant aqueux et deux
procédures par étape ont été développées. La concentration du
thiol alcane dans la solution de déposition va de la gamme
molaire à la gamme inf ramicromolaire, de 0,5 à 2,0
millimolaire étant la plus répandue. Le substrat en or est
20 incubé/placé en contact avec la solution de déposition pour
moins d'une seconde à plusieurs jours selon la procédure. Le
temps le plus habituel est une incubation d'une heure à une
incubation pendant toute la nuit. L'incubation est
habituellement effectuée à température ambiante, bien que des
25 températures supérieures à 50 °C soient communes.
Les couches monomoléculaires mélangées qui contiennent l'ADN
sont habituellement préparées en utilisant une procédure en
deux étapes. L'ADN thiolé est déposé au cours de la première
30 étape de déposition et la formation de la couche
monomoléculaire mélangée est complétée au cours de la seconde
étape au cours de laquelle une seconde solution thiol sans ADN
est ajoutée. La seconde étape implique fréquemment un
chauffage léger pour promouvoir la réorganisation de la couche
35 monomoléculaire.198
Procédure générale pour la formation de SAM déposée d'une
solution organique
Une surface en or propre a été placée dans un flacon propre.
Une solution de déposition d'ADN dans un solvant organique a
5 été préparée dans laquelle la concentration en thiol total
était d'environ 400 pM à 1,0 mM. La solution de déposition
contenait de l'ADN modifié thiol et des molécules diluantes
thiol. Le rapport ADN/diluant était- habituellement entre 10:1
et 1:10, 1:1 étant préféré. Les solvants préférés sont le
10 tétrahydrofuranne (THF), 1'acétonitrile, le diméthylforamide
(DMF) ou des mélanges de ceux-ci. La solution de déposition
d'ADN suffisante est ajoutée au flacon de manière à couvrir
complètement la surface de l'électrode. Le substrat en or est
mis à incuber à température ambiante ou légèrement supérieure
15 à la température ambiante pendant 5 à 30 minutes. Après
1'incubation initiale, la solution de déposition est enlevée
et une solution de molécules diluante seulement (100 pM-1,0
mM) est ajoutée au solvant organique. Le substrat en or est
mis à incuber à température ordinaire ou au-dessus de la
20 température ordinaire jusqu'à ce qu'une couche monomoléculaire
complète se soit formée (10 minutes-24 heures). L'échantillon
en or est enlevé de la solution, rincé dans un solvant propre
et utilisé.
25 Procédure générale pour la formation de SAM déposée d'une
solution aqueuse
Une surface en or propre est placée dans un flacon propre. Une
solution de déposition d'ADN dans l'eau est préparée dans
laquelle la concentration thiol totale est entre un pM et
30 200 pM. La solution aqueuse a fréquemment du sel
(approximativement 1 M) , cependant la solution de déposition
contient de l'ADN modifié thiol et souvent une molécule
diluante thiol. Le rapport ADN/diluant est habituellement de
10:1 à 1:10, 1:1 étant préféré. La solution de déposition
35 d'ADN est ajoutée au flacon de manière à ce que le volume de
solution ?recouvre complètement la surface de l'électrode. Le
substrat en or est mis à incuber à température ambiante ou199
légèrement au-dessus de la température ambiante pendant 1 à 30
minutes, 5 minutes étant habituellement suffisant. Après
l'incubation initiale, la solution de déposition est enlevée
et une solution de molécules diluante seulement (10 pM-1,0 mM)
5 est ajoutée soit darts de l'eau soit dans un solvant organique.
Le substrat en or est mis à incuber à température ambiante ou
au-dessus de la température ambiante jusqu'à ce qu'une couche
monomoléculaire . complète, soit- formée -(-10- minutes-24 heures) r
L'échantillon en or est enlevé de la solution, rincé dans un
10 solvant propre et utilisé.
Couches monomoléculaires sur des électrodes en boule Au
Créer des électrodes en boule Au : utiliser une lame de rasoir
pour couper des longueurs de 10 cm de fil d'or (127 pm de
15 diamètre, pureté 99,99 % ; par exemple d'Aldrich). Utiliser
une aiguille de calibre 16 pour passer le fil à travers un
septum de caoutchouc naturel #4 (de la taille qui convienne
pour aller sur un tube eplendorf PCR H mL) . (Ceci sert à
supporter le fil et à sceller les tubes au cours de la
20 déposition. Voir ci-dessous). Utiliser une flamme à combustion
propre (méthane ou propane) pour faire fondre un centimètre du
fil et former une sphère liée à l'extrémité du fil. Ajuster la
longueur du fil de telle manière que lorsque le tube PCR sera
scellé, la boule en or sera positionnée près du fond, pour
25 qu'elle puisse être submergée dans 20 pL de liquide. Le jour
de 1'utilisation, plonger les électrodes dans 1'eau régale
(4:3:1 H20:HC1:HN03) pendant 20 secondes puis rincer
abondamment à l'eau.
30 Dérivatisation : pendant 5 minutes, chauffer 20 pL d'aliquotes
de solutions de déposition (2:2:1 DNA/H6/M44 à 833 pM total
dans du DMF) dans des tubes PCR sur un bloc PCR à 50 °C. Puis
mettre chaque électrode dans un tube de solution de déposition
(en submergeant juste la boule en or, le moins possible de la
35 "tige" du fil) et les mettre à température ambiante. Incuber
pendant quinze minutes avant de transférer les électrodes dans
les tubes PCR avec 200 pL de 400 pM M44 dans du DMF (en200
submergeant aussi une grande partie de la tige du fil) .
Laisser dans du M44 à température ordinaire pendant 5 minutes,
puis mettre sur le bloc PCR et faire fonctionner HCLONG.
Enlever les électrodes de la solution M44, les plonger dans 6x
5 SSC, et les placer 'dans des tubes PCR avec 20 pm de solution
d'hybridation. Plonger les électrodes dans 6x SSC avant la
mesure ACV.
HCLONG : 65 °C 2", -0,3 °C/s à 40 °C, 40 °C 2', +0,3 °C/s à
10 55 °C, 55 °C 2', -0,3 °C/s à 30 °C, 30 °C 2', +0,3 °C/s à
35 °C, 35 °C 2', -0,3 °C/s à 22 °C.
Fabrication de cartes de circuits imprimés
Une carte 18" x 24" x 0,047" de FR-4 (General Electric) avec
15 une feuille de cuivre d'une demi once sur chaque côté a été
percée conformément au mémoire (dossiers Gerber). La carte FR-
4 est plaqué avec un dépôt auto-catalytique de cuivre (500
micropouces) pour faire les forages spécifiques conducteurs,
puis la carte est plaqué avec 500 micropouces de plus de dépôt
20 électrolytique de cuivre. A la suite du plaquage de cuivre, la
carte est décapée conformément au mémoire par décapage de
chlorure cuivrique (attaque chimique). La carte décapée est
alors plaquée avec 400 micropouces de dépôt électrolytique de
nickel avec un brillanteur puis avec 50 micropouces d'or mou
25 (pureté 99,99 %). La carte en or est recouverte d'un masque de
soudure photosensible (Probimer 52, Ciba-Geigy Co.) sur chaque
côté de la carte. La visualisation se fait conformément au
mémoire. 14 électrodes de capteurs électriques qui ont un
diamètre de 250 microns et deux électrodes plus grosses
30 (diamètre de 500 microns) sont créées avec des dérivations
isolées amenant à des contacts plaqués d'or sur le bord de la
carte de circuit imprimé. La carte avec le masque de soudure
est alors entaillé conformément au mémoire pour créer des
tranches individuelles de l"xl". Une pâte de chlorure
35 argent/argent est appliquée sur l'une des deux plus grosses
électrodes (ERCON R-414). La carte est alors nettoyé par
plasma avec un mélange de plasma argon/oxygène. A la suite du201
nettoyage, la carte est stockée dans un sac tapissé de
feuilles avant l'utilisation.
Déposition de couches monomoléculaires sur les cartes à
5 circuits imprimés '
Les cartes à circuits imprimés sont enlevées du sac tapissé de
*
feuilles et immergées dans une solution d'acide sulfurique
10 % pendant 30 secondes. A la .suite, du traitement par acide
sulfurique; les cartes sont immergées dans deux bains-marie
10 Milli-Q pendant 1 minute chacune. Les cartes sont ensuite
séchées sous un jet d'azote. Les cartes sont placées sur une
table X-Y dans une chambre de simulation d'humidité et une
goutte de 30 nanolitres de solution de déposition d'ADN est
placée sur chacune des 14 électrodes. La solution de
15 disposition d'ADN est composée de 33 pM d'ADN thiolé, de 33 pM
de fil de deux unités de phénylacétylène (H6) et de 16 pM de
M44 dans 6xSSC (900 mM de chlorure de sodium, 90 mM de citrate
de sodium, pH 7) w/ 1 % de triéthylamine. La goutte est
incubée à température ordinaire pendant 5 minutes puis elle
20 est enlevée par un rinçage dans un bain-marie Milli-Q. Les
cartes sont immergées dans un bain à 45 °C de M4 4 dans
l'acétonitrile. Après 30 minutes, les cartes sont enlevées et
immergées dans un bain d'acétonitrile pendant 30 secondes
suivies d'un bain-marie Milli-Q pendant 30 secondes. Les
25 cartes sont séchées sous un jet d'azote.
Exemple 2
Détection de séquences cibles
Déposition de couches monomoléculaires sur les cartes à
30 circuits imprimés
Comme ci-dessus, les cartes à circuits imprimés sont enlevées
des sacs tapissés de feuilles et immergées dans une solution
d'acide sulfurique 10 % pendant 30 secondes. A la suite du
traitement par acide sulfurique, les cartes ont été immergées
35 dans deux bains-marie Milli-Q pendant 1 minute chacun. Les
cartes ont été séchées sous un jet d'azote. Les cartes ont été
placées sur une table X-Y dans une chambre de simulation202
d'humidité et une goutte de 30 nanolitres de solution de
déposition d'ADN a été placée sur chacune des 14 électrodes.
La solution de déposition de l'ADN était composée de 33 pM
d'ADN thiolé, de 33 pM de fil de 2 unités de phénylacétylène
5 (H6), et de 16 pM' de undec-1-en-llyltri(éthylèneglycol)(HS-
CH2)n-(OCH2-CH2)3-OH) dans 6x SSC (900 mM de chlorure de
sodium, 90 mM de citrate de sodium, pH 7) w/1 % de
triéthylamine.. 3_ électrodes ont été - tachées avec une solution-
contenant 'de l'ADN 1 (5'-ACCATGGACACACAGAT(CH2)i6SH-3') . 4
10 électrodes ont été tachées avec une solution contenant de
l'ADN 2(5'TCATTGATGGTGGTCTCTTTTAACA((CH2)16SH-3'). 4 électrodes
ont été tachées avec ADN
3(5'CACAGTGGGGGGACATCAAGCAGCCATGCAAA(CH2)i6SH-3'). 3 électrodes
ont été tachées avec ADN 4 (5'-TGTGCAGTTGACGTGGAT(CH2) i6SH-3 ' ) .
15 La solution de déposition a été mise à incuber à température
ambiante pendant 5 minutes puis la goutte a été enlevée par
rinçage dans un bain-marie Milli-Q. Les cartes ont été
immergées dans un bain à 45 °C de M44 dans l'acétonitrile.
Après 30 minutes, les cartes ont été enlevées et immergées
20 dans un bain d'acétonitrile pendant 30 secondes suivi d'un
bain-marie Milli-Q pendant 30 secondes. Les cartes ont été
séchées sous un jet d'azote et conservées dans des sacs
tapissés de feuilles balayées avec de l'azote avant
utilisation.
25
Hybridation et mesure
Les cartes modifiées ont été enlevées des sacs tapissés de
feuilles et adaptées à une chambre échantillon moulée par
injection (cartouche). On a fait adhérer la chambre à la carte
30 en utilisant un ruban adhésif double face, la chambre avait un
volume total de 250 microlitres. Une solution d'hybridation a
été préparée. La solution contient 10 nM de cible ADN (5'-
TGTGCAGTTGACGTGGATTGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGA
GTCATCCAGT-31(D-998), 30 nM de sonde signalante (D-1055) et 10
35 nm de TCTACAG (N6) C (N6) ATCTGTGTCCATGGT-3 ' (N6 est montré sur la
figure ID du document PCTUS99/01705 ; il comprend un ferrocene203
connecté par une chaîne carbone 4 à l'oxygène 2' du ribose
d'un nucleoside). La sonde de signalisation est comme suit :
5'-(C23),-N87-N87-N87-N87-ATC CAC GTC AAC TGC ACA-3' (D-1055)
I I I I
C23 C23 C23C23
C23 C23 C23 C23
C23 C23 C23 C23
C23 C23 C23 C23
5 N87 est un point de ramification comprenant une. structure-? en
anneau. C23 est montré sur la figure IF de PCTUS99/01705. Dans
une solution contenant 25 % de tampon AL" de lyse Qiagen,
455 mM NaC104, 195 nM NaCl, 1,0 mM de-mercaptohexanol et 10 %
de sérum de veau foetal. 250 microlitres de solution hybride
10 ont été injectés dans la cellule et mis à hybrider pendant 12
heures. Après 12 heures, la puce hybridée a été branchée à un
amplificateur de transconductance maison avec une circuiterie
changeante. L'amplificateur de transconductance a été équipé
avec une circuiterie sommatrice qui combine une rame DC pour
15 la carte DAQ de l'ordinateur et une onde sinusoïdale AC de
1'amplificateur de phase (SR830 Stanford Instruments). Chaque
électrode a été examiné séquentiellement et les données ont
été sauvées et manipulées en utilisant un programme maison
conçu en utilisant Labview (National Instruments). La puce a
20 été observée entre -100 mV et 500 mV (pseudo électrode de
référence Ag/Ag/Cl) DC avec une onde sinusoïdale superposée de
25 mV (50 mV de crête à crête), 1000 Hz. Le courant sortant a
été alimenté dans l'amplificateur de phase et le signal 1000
Hz a été enregistré' (technique ACV) . Les données pour chaque
25 set de bloc ont été compilées et on en a fait une moyenne.
Ip Intensité relative IP
ADN 1 (2 Fc positif) 34 nA 0,11
ADN 2 (dosage intercalé positif) 218 nA 0,7
ADN 3 (négatif) 0,3 nA 0,001
ADN 4 (dosage intercalé positif) 317 nA 1
Les résultats sont montrés sur la figure 14.204
REVENDICATIONS
1. Composition comprenant un substrat comprenant :
5 a) une première surface comprenant :
i) une rangée d'électrodes de détection comprenant
chacune un ligand de capture lié d'une manière
covalente. ; - - - .....---
ii) au moins une première électrode
10 d'électrophorèse ;
b) une seconde surface comprenant au moins une seconde
électrode d'électrophorèse ; et
c) au moins un canal reliant lesdites première et
seconde surfaces.
15
2. Composition selon la revendication 1, où ledit canal
comprend un matériau de couche de permeation.
3. Composition selon la revendication 1, où ledit canal
20 comprend une membrane,
4. Composition selon la revendication 1, comprenant en
outre une chambre de détection, où ladite chambre de
détection comprend ladite surface.
25
5. Composition comprenant une chambre de détection
comprenant :
a) un substrat comprenant :
30 i) une première surface comprenant :
1) une rangée d'électrodes de détection
comprenant chacune un ligand de capture
lié d'une manière covalente ;
ii) une seconde surface ;
35 iii) au moins un canal reliant lesdites première
et seconde surfaces ; et205
b) un matériau absorbant en contact avec ladite
seconde surface.
6. Composition selon la revendication 5, où ledit canal
5 comprend un matériau de couche de permeation.
7. Composition selon la revendication 5, où ledit canal
comprend une membrane. ---?""'"
10 8. Procédé de détection d'un analyte cible dans un
échantillon comprenant :
a) la concentration dudit analyte cible dans une
chambre de détection comprenant :
15 i) une première surface comprenant :
1) une rangée d'électrodes de détection
comprenant chacune un ligand de capture
lié de manière covalente ;
2) au moins une première électrode
20 d'électrophorèse ;
ii) une seconde surface comprenant au moins une
seconde électrode d'électrophorèse ; et
iii) au moins un canal reliant lesdites première
et seconde surfaces ;
25 b) la liaison dudit analyte cible audit ligand de
capture pour former un complexe de dosage, où ledit
complexe de dosage comprend en outre au moins une
moitié de transfert d'électrons (ETM) ; et
c) la détection de la présence de ladite ETM en
30 utilisant ladite électrode de détection.
9. Procédé de détection d'un analyte cible dans un
échantillon comprenant :
35 a) la concentration dudit analyte cible dans une
chambre de détection comprenant :
i) un substrat comprenant :206
1) une première surface comprenant ;
A) une rangée d'électrodes de
détection comprenant chacune un
ligand de capture lié d'une manière
5 <? covalente ;
2) une seconde surface ;
3) au moins un canal reliant lesdites
première et seconde surfaces-; et'
ii) un matériau absorbant en contact avec ladite
10 seconde surface ;
b) la liaison dudit analyte . cible audit ligand de
capture pour former un complexe de dosage, où ledit
complexe de dosage comprend en outre au moins une
moitié de transfert d'électrons (ETM) ; et
15 c) la détection de la présence de ladite ETM en
utilisant ladite électrode de détection.1/26
FIG. -1A

/ / JrÇ-2 i\ st f /s40
/ N-------^ -----r? y//
/^-30
FIG.- 1B
s- 60 ^50
FIG..1C
A° A°
FIG.. 1E
FIG.-1D
FIG..1F2/26
FIG.-2
535
FIG.. 123/26
120
100
106
n
~r~z
/ 7
-r~7
107
\/r~7
FIG.-3A
120
"°-/fïï^
112
100
106
'n
V
S
/ 7
7 7 7
107
^-105
FIG.-3B
132
*>
130
?131
^E
Ç^f
120
100^=3=^
102
106
~7
/
y^
t^
^-110
112
n
7
T
107
^-105
FIG.-3C4/26
107
FIG..4A
120
/ / y
FIG..4B
/ / '/ vx/ /
\-106 V_705 ^08
t
««n 112-^
3
<-
120
110
\
100
<SF%i
152
-2P
106
A
142
7 7 7[ 7 7 7 7\7
106
^-105
F1G..4C
5/26
106
FIG..4D
COURANT DE CRETE CONTRE LOCALISATION
Ip (nA)
«JJU-
300- y//// -
250- '777, ?
200- :t0ÈÊM
150- SÄEÄ -
100- ^lir^lJK;-.^::'^ -
50- w>, -
0- N\V
ADN 1 ADN 2 ADN 3 ADN 4
ECHANTILLON ADN
FIG..146/26
*-135
*~135s-*-135 ^? *-735^-*-735
v**? w- I JJ/-:
y.yy y /:/' //;
^ ros Lj07
FIG.. 5A
108
n
,yE
7r77
°y\V
772-
720
/^*-735^*-735^-*-735/-*-735
X
7~7"
/
z
/ 7 7
108
/ 7 7
105
107-
FIG..5B
?^FW F^
112
?145
106
rn
120-
?^*-135
*-135
108
7 '7 7'7\/' S V ÏVS'
V.1/JC V107
FIG..5C7/26
?*-135
*-135/ s-*-135
?*-135
*-135
7 7 7 7 7 7 7 7 7 7 7
105 FIG..5D

106
108
7 7.77 7 77 777 7 77 7
FIG..5E
^r-150
151
ULri-£
152
^145^141
142
7 7 '7 7 7 7 7 7 7 7 7 7 7\7
^m FIG..5F
8/26
^iio^iii n
772
760"
767
762
t=ï
y172
153
70
A
152
120
\14.^*141
\
142
105 FIG..5G
*-135
FIG..5H9/26
*-135
*-135
f r*-135
14?cr
106
FIG..6A
201
FIG..6B
FIG..
?C
220
^
237
230 232
^-107
7 7 7 7 7 7 7 7 7x7 7
^105
240 ,*-135
*-735
*-735
FIG.-
107
ri0810/26
FIG.-6E
205
270
220
*~135^*-135
*-135
^*-135
200'
106
Ir
706
y y y y ,7' y 777 y\y 7
r
106
*-135
-13ll35
^-135
\
220
FIG..6F -**!
7
-y
-7-7
rx/
706
7
^-105
h 107
y
106
V
*-735
r*-135
^l ( r'r?-»?
r-i ç-108
y yy y y-y^rrr
^705 107-11/26
12/26
13/26
<^z7^^ = PREMIÈRE PARTIE HYBRIDABLE DE LASONDE DE MARQUAGE
= LIEUR DE RECRUTEMENT
(ETM)n (ETM)n
?(ETM)n
?(ETM)n
(ACIDE NUCLÉIQUE)
ETM ETM ETM MÉTALLOCÈNE
(MÉTALLOCÈNE)n
A = REMPLACEMENT DE NUCLEOSIDE E = POLYMÈRE DE MÉTALLOCÈNE LIÉ À
B = LIAISON À UNE BASE UN RIBOSE, PHOSPHATE OU BASE
C = LIAISON À UN RIBOSE F= STRUCTURE DENDRIMÈRE LIÉE PAR
D - LIAISON À UN PHOSPHATE L'INTERMÉDIAIRE D'UN RIBOSE,
D'UN PHOSPHATE OU D'UNE BASE
F IG..7A
< (ACIDE NUCLÉIQUE)
G = LIAISON PAR L'INTERMÉDIAIRE
<
D'UNE "STRUCTURE DE
RAMIFICATION" AU TRAVERS
B sss^r ETM D'UN RIBOSE, D'UN PHOSPHATE
OU D'UNE BASE
*,
C'N^r ETM
0*w ETM
(MÉTALLOCÈNE)n
(ETM)n
(ETM)n
(ETM)n
(ETM)n
V---------------------------------------------------------- --------------------------------------------------------->
F1G..7B<5^__^^^
V.
RETICULATION
FACULTATIVE
14/26
r~ I- h-
UJ Ul UJ
UJ
(ACIDE NUCLÉIQUE)
; ? ? I
ETM ETM ETM (MÉTALLOCÈNE)n
FIG..7C
J
(MÉTALLOCÈNE)n
\
<2$zéP$^^ ------------H-----------I
,ETM
j_ (ACIDE NON
J NUCLÉIQUE)
LU LU UJ UJ
V
H = LIAISON DE POLYMÈRES DE MÉTALLOCÈNE
I ?= LIAISON PAR L'INTERMÉDIAIRE D'UNE STRUCTURE DENDRIMÈRE
J = LIAISON UTILISANT DES LIEURS STANDARD
FIG..7D
J
<2^2^2^2^£^G3«2^£5^
(MÉTALLOCÈNE)n
(ETM)n
(ETM)n
(ETM)n
(ETM)n
ETM
V
FIG.-7E
j15/26
OQ .
I I
8
ù: ?
00
1
h- f- h-
2 5 2
a Q Q
s O eg X O O O cm eg X X o o
1 CV CM CM
X X X
(3 O CM X O Ü CM CM X X
^^ Ü O o
u. O CM O O CM CM
X X X
o O o
\c',/
i
CM
X
1 a
-1 o i
z: ? 1 -CL
X ^ ^7 \
O x O
I 1 CM X
O o
g lo 1 CM X
< e? o
o i Ü
z t? 2:
< ?
h- ?
1/1 <
z i
(*-l «^ i
< j^~
% *-*,,__
b ? <5
IESE t
I UJUJ
i? 1 St-
> r? cr ylit .£
t/i O o_ £îû
a. D.
i*n <
X X X
o O O
CM CM CM
X X X
a o o
CM CM CM
X X X
Ü o o
CM CM CM
X X X
Ü o o
o o o
CM CM CM
X X X
Ü o o i? __
v,/ 5°
2 1 CH-IXA
O t-?.0
CM X CM X nil? 1?
Ü CM X o o o 1 RIEMI L'OB POIN'
V?' O- -û_=0 *'< wJS
1 o S D'API JUSQU ITÉ#D 1 DÉSIRI
k,
3<l_ll-^
Lf> 1 r n t/)|_zO W;UJ < t_
O Hd-d5
1 i PROC RERÉ LAQI MIFIC
1
< p i > * i UJ h- UJ < U'iuûa
i-
cc
o
CL
a
« s
16/26
LO
XXX
OOO
CM CM (M
XXX
OOO
CM CM CM
XXX
OOO
CM CM CM
XXX
OOO
OOO
CM CM CM
XXX
OOO
o
CM CM
x x
<N O
XXX
OOO
CM CM CM
XXX
ooo
CM CM CM
xxx
ooo
CM CM CM
XXX
OOO
OOO
CM CM CM
XXX
OOO
77
XXX
OOO
CM CM CM
XXX
OOO
CM CM CM
,xxx
OOO
CM CM CM
XXX
OOO
OOO
CM CM CM
XXX
OOO
J- I- J-
UJ UJ UJ
I I I
OOO
CM CM CM
XXX
OOO
CM CM CM
XXX
OOO
CM CM CM
XXX
OOO
OOO
CM CM CM
XXX
OOO
L
X
o
o
h- H r-
Uü LU LU
f I I
OOO
CM CM CM
XXX
OOO
CM C«J CM
XXX
OOO
CM CM CM
XXX
O CJ o
ooo
CNJ CM CM
XXX
OOO
CM
X
o
O
f- H- l?
LU LU LU
I 1 j
OOO
CM CM CM
XXX
ooo
CM CM CM
XXX
OOO
CM CM CM
XXX
a o a
ooo
CM CM CM
XXX
O ü o
^7
CM
X
o
o
0-cl__o O-Q-rro 0-a.=o
o o o
CM CM CM
X X X
o o o
CM CM CM
X X X
o o o
CM CM CM
X X X
o o o
o o o
CM CM CM
X X X
o o o
v,/
1
CM
X
o
o
? 1
O- -ü_=o
1
O
l
O
1
o
1
!~
1
<
CQ
00
I
ei
co
cc
O
Q-
Q-
r>
co17/26
t 1 03 ? i i
FIG.. FIG. Lt '
1
J-
LT
O
a
a
C/)
i?
LX
O
a
CL
co
co
co
O)
I
d
Lt
z
I-
z
<
3
Z
UJ
e
<
a
z
b
UJ
VI
'UJ
X
H-
z
>?
U.
x
H
U-
3
CD
c
h-
O
\
O'
x
.O
o
o
lr~
\
O*
X
,o
f-
o
s
rwNL
r
'V
X
O
x m
O
X
to
18/26
CO
3
<
I-
Z
UJ
S
UJ
c_
-
a.
<
19/26
3
ujjfj
up
=2
atz
*_>o
~*UJ
I?-UI
uiO
?s s
UJUJ
C_U-
J=g
si
l/l O
tA tA
o ?*--
C--J
Q. UJ
UJ3
OC/
UJ
UJ
u
S
UJ
u.
UJ
-I
£5
XH
to=>
O- uj
S«uj
*¥ u-
Ou-
yy
SE

Q. tA
UJ
Z
'UJ
u
"g
S S
z-
UJ-3
UJÛ
X.UJ
35
ûo
UJ V)
b<
û-j
?*? uj
I-
z
-
<
0_j_j
tn*5 co
o=?z
Û_QÛ
2
O
CM
X
o
CM
X
o
o
V-
o
I
CM
X
o
CM
X
o
0=cnr=o
CM
X
o
CM
X
o
o
o
co
KJ
UJ
I-
2
u.
H
UJ
Ul
O
_i
-UJ
UJ
H
I-
O
Ci
I
d
Lt-Si----- + Br
I
Cl
'OH
20/26
TETRA20L
CHpClp
Br
O------Si-
N14
NH,
HO
NH2
V? N3H/DMF/N14 H°-|X| ?S ^PYRIDINE
VY
H20
OH OH
DMT Cl / DMAP / PYRIDINE DMTO
OH O
N15
NHPAC
to
*o
I
?Si-
OH O
N16
*o
I
?Si-
NHPAC
NCCH2CH2OPCIN(iPr)2
DIPEA/DMAP/CH2CI2'
DMTO
O O^
ji >v ^O?Si-
N"" ^OCH2CH2CN I
N17
FIG..1021 /26
Lt22/26
UJ
CQ
co
Y?
I
ej
Lt
Q
co
Y?
!
e?
Lt
UJ
ÛZ
ai o
û ^
_s
UJ
UI
</l
'UJ
o?
dg
ujV-
JU
UI UJ
-J
?UJ
b
^
czr
u
UJ
b
UJ
«ï
fcS
UJl-
_J U
UJUJ
_J
UJ
b
UJ o
o
C_
H
u
UJ
? v _i
s \ f co
r*. /^-^ Y^
! ?o 1
O 777- J d
l ^^m
Lt LUX- IL
u
23/26
t~ '? i
A
50
25> 25^ 25A
r^20 ) r-20 ^20 1 ,-20 25^"
IP^ 30 to^ 3
s40
FIG.- 15A
A
50
25-N 25-s 25A
)' ' ) ' ' \ '?' I
37 on^ I T rCöö ons
30
30^ l?j------1^30 30^ i
10-^ 27^
/?40
FIG.. 15B
_15C
-15D
-15E24/26
25N 20^ 25
25^20^50
FIG.? 15F
25y 20y 25" j ^20
50J 30J
FIG..15G
FIG.. 16A
r r500
PORT D'ENTREE
MEMBRANE
SEMI-PERMÉABLE
ELECTRODE
DE DÉTECTION
MEMBRANE
SEMI-PERMÉABLE
'JJji'Ji"Ji^^////A
1\ CARTE A
v CIRCUIT
IMPRIMÉ
V
MATERIAU
ABSORBANT
TROU-"'
AU TRAVERS DU PCB
FIG..16B
V TROU AU
TRAVERS DU PCB25/26
PORT D'ENTRÉE
l--?-*«'-«**?__? .. -..? ??? ? ? -/-?? --------------.-w .|T,,,ii,.i_--- CAKIfc A
r? ' CIRCUIT
y^zrtt^
mim.«'*1
___3
^^rtfj
TROU -/ ELECTRODES
AU TRAVERS DU PCB D'ÉLECTROPHORÈSE
FIG.- 16C
r
IMPRIME
"V MEMBRANE
SEMI-PERMÉABLE
^ MATÉRIAU
ABSORBANT
^ TROU AU
TRAVERS
DU PCB
PORT D'ENTRÉE
ELECTRODES
D'ÉLECTROPHORÈSE
MEMBRANE
ELECTRODE DE
SEMIPERMEABLE / OtTECTION
»?? "m i»?wn?f
MEMBRANE
SEMI-PERMÉABLE
ELECTRODES
ÉLECTROPHORÈSE
Vr/y/m^rTTPPZ^rrrrrAiWr/M
fCARTE A
V ciRcurr
IMPRIMÉ
TROU AU
TRAVERS OU PCB
ELECTRODES
D'ÉLECTROPHORÈSE
FIG.-16D
V
MATERIAU
ABSORBANT
TROU AU
TRAVERS
DU PCB
1126/26
s PORT D'ENTREE
ELECTRODES -ELECTRODE DE
ELECTRODES
D'ÉLECTROPHORÈSE
TROU-7
AU TRAVERS DU PCB
FIG.. 16E
CARTE A
CIRCUIT
IMPRIME
MEMBRANE
SEMI-PERMÉABLE
\- MATÉRIAU
ABSORBANT
TROU AU
TRAVERS
DU PCB
PORT D'ENTREE
ELECTRODES
D'ÉLECTROPHORÈSE
MEMBRANE ELECTRODE DE
SEMI-PERMÉABLE r DÉTECTION
TROU
AU TRAVERS DU PCB
ELECTRODES
D'ÉLECTROPHORÈSE
ELECTRODES
D'ÉLECTROPHORÈSE
CARTE A
CIRCUIT
IMPRIMÉ
FIG..16F
MATERIAU
ABSORBANT
TROU AU
TRAVERS
DU PCB