European, Belgian 6 Dutch Patent Attorneys
Benelux & European Trade Mark and Design Attorneys
200001 (HV)
*22-12-03-1100830*
(3MSJS
E£0D
SERVICE PUBLIC FEDERAL
ECONOMIE, PME, CLASSES
MOYENNES & ENERGIE
Office de la Prop. Intellect.
Blvd. Du Roi Albert II, 16
B-1000 BRUXELLES
MORE rtMN A MARK
yp/ooBo
Diegem, le 18 décembre 2003.
V/Ref. : -
N/Ref. :EPBE 876511
Messieurs,
Dépôt d'une traduction d'un brevet européen.
NFORMATIQUE
l__
19.01.2004
Nous vous remettons en annexe un exemplaire de la traduction du texte du brevet européen
dont les données sont reprises ci-dessous :
Date de dépôt : 28 juillet 1999
Date de délivrance ; 1 octobre 2003
Numéro de publication : 1100830
Titulaire(s) : Micromet AG
Nous joignons également une formule de procuration.
Nous vous serions obligés de bien vouloir nous accuser réception de la présente en nous
retournant la copie ci-jointe, munie de votre cachet.
Veuillez agréer, Messieurs, nos salutations distinguées.
P. VOSSWINKEL
nv GEVERS & VANDER HAEGHEN sa
Intellectual Property House
Holidaystraat, 5
1831 Diegem - Brussels (Belgium)
T:+32 2 715 37 11
F : +32 2 535 99 00
patent s@ge vers. com
www.gevers.com
' > > t ; i / ;
: i.....~"~.......'"......!
j ;2 2. -12- 2C03 !

BTW-TVA : BE 451 659 120
HRB-RCB : 576 337
BE53 3101 0126 4753 BBRUBEBB
BE39 4279 1856 7119 KREDBEBB
Cnnaml Turms fm rm-enm sltlif - J\)giimrmii Voorwaaränn ïiii Kixiriijda - Conditions GAnfralos voir voiso\
POUVOIR - VOLMACHT - POWER OF ATTORNEY
DEMANDES DE BREVET - OCTROOIAANVRAGEN - PATENT .APPLICATIONS
BREVETS - OCTROOIEN "-PATENTS
CERTIFICATS COMPLEMENTAIRES DE PROTECTION (CCP) - AAMVULLENDE BESCHERMINGSCERTIFICATEN (ABC)
SUPPLEMENTARY PROTECTION CERTIFICATES (SPC)
Ta soussignée/Le(s) soussigné(s)
Ondergeteksnde(n)
Hie undersigned
Micromet AG
Staffelseestraße 2
D-81477 München
Phone+49898952 77-0-Fax-l05
désigne(nt) comme mandataires les personnes suivantes :
duidt (duiden) de volgende personen als octrooigemschtigde san :
appoints (appoint) the fou owing persons as ogen.' :
Claeys Pierre, Gevers Florent, Gevers François, Gevers Jacques? Grisar Daniel, Luys Marie-josé,
Pieraerts Jacques, Quintelier Claude, Rossini - de Taxis du Poët Dominique, Schmitz Yvon,
Van Reet Joseph, Vosswinkel Philippe
c/o Gevers & Vander Haeghen, Brussels Airport Business Park Holidaystraat, 5 1831 Diegem
pour ]a/le(s) représenter auprès de l'Office belge de la Propriété Industrielle en ce qui concerne
om haar/hem/hen te vertegenwoordigen bij de Belgische Dienst voor de industriële Eigendom voor wat betreft
to represent the undersigned before the Office belge de la Propriété Industrielle in connection with
la demande de brevet / ie brevet belge
de Belgische octrooiaanvraag of hel Eelgisch octrooi
the Belgian patent application /patent
VI la demande de brevet-/ Ie brevet europeen en Belgique
de Europese octrooiaanvraag of het Europees octrooi in £e!gië
the European patent application /patant in Belgium
A Aoo o 2><
Ja demande de CCP / le CCP belge concernant le brevet de base
de belgische ASC-aanvraag / heî Ë-elgisch ABC m.b.t. het basisoctrooi
the Belgian SPC application / SPC concerning the basic patent
et pour faire ou recevoir tout paiement en son/leur nom
en om beîalingstransaciies in haar/zijn/hun naam uit te moeren
and to make or receive any and ail payments on behalf of the undersigned
Nom du signataire
Naam ondergetekende(n)
Name of the person signing
CUO^o^ S£*-
Fonction du signataire
Functie ondergetekende(n)
Capacity in which the person signs
Cbo
Signature(s)X
Handtekening(en)
Signature(s)
C^
Date
Datum
Dare
$*pV«^V** Z$i1oo\(11) Numéro de publication
européen : 1100830
(12) TRADUCTION DU BREVET EUROPEEN (BI)
(21) Numéro de dépôt de la demande de brevet européen : 99944302
(22) Date de dépôt de la demande de brevet européen : 28/07/99
(54) Titre : HETEROMINICORPS
(30) Priorité(s) : EP 98114082 - 28/07/98
(73) Titulaire du brevet Micromet AG
(45) Numéro et date du Bulletin Européen où la mention de la délivrance a été publiée : 03/40 du 01/10/03
(84) Etats contractants désignés :
AT BE CH CY DE DK ES Fl FR GB GR IE IT LI LU MC NL PT SEN° de publication européen 1 100 830
N° de dépôt de la demande 99 944302.1
Date de Dépôt 28 juillet 1999
Titulaire : MICROMET AG
Titre : Hétérominicorps
Mention de délivrance publiée le lGr octobre 2003
dans le Bulletin européen des Brevets n° 03/40
10 La présente invention concerne un composé multifonctionnel, apte
à être produit dans une cellule hôte de mammifère sous forme
d'un hétérodimère pouvant être sécrété et totalement
fonctionnel, formé de deux chaînes polypeptidiques, dans lequel
une desdites chaînes polypeptidiques comprend en tant que seul
15 domaine de la région constante d'une chaîne lourde d'une
Immunoglobuline le domaine CH1 et 1'autre chaîne polypeptidique
comprend le domaine CL constant d'une chaîne légère d'une
Immunoglobuline, ledit composé multifonctionnel comprenant en
outre au moins deux et jusqu'à quatre (poly)peptides ayant des
20 fonctions de récepteur ou de ligand différentes, fusionnés avec
lesdits domaines de région constante, dans lequel, en outre, au
moins deux desdits (poly)peptides différents sont dépourvus
d'une affinité intrinsèque l'un pour l'autre et dans lequel
lesdites chaînes polypeptidiques sont liées par 1'intermédiaire
25 desdits domaines constants. De préférence, lesdits domaines
ayant une fonction de récepteur ou de ligand sont sous la forme
d'un fragment scFv et/ou sont des molécules effectrices immuno-
modulatrices. De manière très préférable, ledit fragment scFv
comprend les régions VH et VL de 1'anticorps murin anti-17-lA,
30 M79, les régions VH et VL de l'anticorps anti-Lewis Y, comme le
montre la fig. 6, ou les régions VH et vL de l'anticorps anti-
CD3, TR66, et/ou ladite molécule effectrice immuno-modulatrice
comprend des cytokines ou chemokines. De plus, la présente
invention concerne des polynucleotides codant pour lesdites
35 chaînes polypeptidiques ainsi que des vecteurs comprenant
lesdits polynucleotides et les cellules hôtes transformées par
ceux-ci ainsi que 1'utilisation des modes de réalisationprécédents pour la production desdits composés
multifonctionnels. De plus, sont prévues des compositions
pharmaceutiques et destinées au diagnostic, comprenant 1'un
quelconque des composés multifonctionnels, polynucleotides ou
5 vecteurs décrits précédemment. L'utilisation du composé
multifonctionnel mentionné précédemment pour la prévention et/ou
le traitement de la croissance de cellules malignes, liées à des
états malins des cellules hématopoïétiques ou à des tumeurs
solides, est également décrite.
10 Au milieu des années 80, le concept d'anticorps bispécifiques a
été développé. Grâce à des anticorps bispécifiques, on peut
réticuler différents antigènes, récepteurs ou ligands qui n'ont
pas d'interaction physiologique 1'un avec 1'autre, en
fournissant ainsi un nouveau moyen d'interférer dans les
15 processus pathologiques, de recruter des cellules effectrices
cytotoxiques pour tuer les cellules cibles, par exemple les
cellules d'une tumeur ou des cellules infectées par un virus, ou
de faciliter 1'élimination des agents pathogènes hors de
l'organisme.
20 On pense généralement que les petites structures d'anticorps
bispécifiques ont un important potentiel pour le diagnostic et
thérapeutique. Contrairement aux versions bispécifiques de
molécules d'immunoglobulines entières (Merchant, Nature
Biotechnology 16 (1998), 677-681), dont on attend qu'elles aient
25 les mêmes propriétés in vivo, et spécialement la longue demi-vie
dans le sérum, que leurs homologues naturels monospécifiques,
les petites structures d'anticorps bispécifiques sont, en raison
de leur poids moléculaire réduit, préférables pour les
applications exigeant des propriétés améliorées de
30 biodistribution. De plus, on a présumé que les petits anticorps
bispécifiques sont aptes à être produits avec des rendements
significativement meilleurs que les versions bispécifiques
basées sur les immunoglobulines entières. Par conséquent,
plusieurs moyens de recombinaison ont été développés pour la
35 production de fragments d'anticorps bispécifiques de ce type,afin de remédier aux faibles rendements des procédés
conventionnels (Carter, J. Hematother. 4 (1995) 463-470).
Les fragments d'anticorps bispécifiques de 1'état de la
technique ne pouvaient habituellement pas être glycosylés, en
5 raison de leur manque de sites de glycosylation. Par conséquent,
les procédés de production ont été basés sur E. coli comme hôte
pour 1'expression, bien que 1'expression fonctionnelle de
dérivés d'anticorps dans E. coli puisse être critique, selon la
réussite de la translocation des chaînes polypeptidiques
10 correspondantes dans 1'espace périplasmatique et selon la
complexité structurelle de la protéine recombinante. Ainsi, il a
été démontré que les anticorps bispécifiques simple chaîne,
consistant en quatre régions variables d'Ig sur une seule chaîne
polypeptidique, ne peuvent pas être exprimés sous forme de
15 protéines fonctionnelles dans le périplasme de E. coli. Au
contraire, les anticorps bispécifiques simple chaîne peuvent
être exprimés sous forme de protéines recombinantes totalement
fonctionnelles à 1'intérieur du trajet sécrétoire des cellules
de mammifères, en permettant ainsi la purification hors du
20 surnageant de la culture (Mack, Proc. Natl. Acad. Sei. USA 92
(1995), 7021-7025).
En général, les stratégies pour l'expression d'anticorps
bispécifiques peuvent être subdivisées en systèmes à deux hôtes
et à un seul hôte (Carter, J. Hematother. 4 (1995) , 463-470) .
25 Dans les systèmes à deux hôtes, les deux spécificités
différentes sont exprimées et purifiées séparément et, ensuite,
combinées in vitro pour former des hétérodimères bispécifiques.
Dans les systèmes à un seul hôte, l'anticorps bispécifique est
exprimé sous la forme de simple chaîne, ou deux différentes
30 chaînes polypeptidiques forment des hétérodimères durant
1'expression dans la même cellule hôte. En principe, les
systèmes à un seul hôte sont plus préférables que les systèmes à
deux hôtes, car les stades additionnels in vitro requis dans les
systèmes à deux hôtes ont tendance à accroître les coûts de
35 production, réduire le rendement et limiter la pureté possibledes anticorps bispécifiques obtenus. Bien entendu, 1'expression
fonctionnelle des dérivés d'anticorps bispécifiques dans un
système adéquat à un seul hôte est également préférable aux
procédés conventionnels fondés sur 1'expression non
5 fonctionnelle, suivie par la dénaturation complète de la
protéine recombinante et ensuite le repliement. Par conséquent,
des procédés efficaces pour l'expression fonctionnelle des
anticorps bispécifiques dans les systèmes à un seul hôte sont
hautement préférables comparativement aux autres procédés.
10 En plus de 1'expression fonctionnelle des anticorps
bispécifiques simple chaîne dans les cellules de mammifère, le
seul système à un seul hôte qui produit principalement des
fragments d'anticorps bispécifiques et qui s'est révélé
réalisable pour l'accroissement de la production est
15 1'expression de dianticorps dans le périplasme de E. coli, qui
est basée sur la dimérisation préférentielle de deux chaînes
polypeptidiques différentes (Hoilinger, Proc. Natl. Acad. Sei.
USA 90 (1993), 6444-6448). Des minianticorps bispécifiques, qui
ont récemment fait 1'objet d'une publication, exprimés également
20 dans le périplasme de E. coli (Müller, FEBS Letters 422 (1998),
259-264) doivent encore prouver leur faisabilité pour
1'accroissement de la production. En ce qui concerne
1'expression fonctionnelle de petites structures d'anticorps
bifonctionnels comprenant au moins une partie non
25 d'Immunoglobuline, seules les cellules hôtes de mammifère
répondent totalement aux exigences de 1'expression. C'est parce
que les portions non-immunoglobulines, telles que les domaines
extracellulaires des récepteurs cellulaires, sont souvent
glycosylées et dépassent fréquemment les sites de liaison de
30 l'antigène avec l'Ig dans la complexité structurelle.
Contrairement aux systèmes de mammifère, les systèmes de E.
coli, de levures et de baculovirus ne répondent pas à ces
exigences ou n'y répondent que partiellement.
Par exemple, beaucoup des hydrates de carbone liés par leur
35 extrémité N-terminale, de glycoprotéines de vertébrés, ne setrouvent pas dans E. coli (par exemple acide sialique) . Ces
hydrates de carbone ont d'importantes fonctions dans la
reconnaissance de cellule à cellule, 1'adhésion et la fonction
de protéine. En outre, 1'O-glycosylation qui se produit aussi
5 dans E. coli est fondamentalement différente des processus d'O-
glycosylation chez le mammifère puisque, entre autres, des
hydrates de carbone différents sont ajoutés.
Comme d'autres 1'ont démontré (Gerstmayer, J. Immunol. 158
(1997), 4584-4590), une forme appropriée pour 1'expression de
10 ces structures d'anticorps bifonctionnels comprenant des parties
non d'Immunoglobuline dans des cellules hôtes supérieures est la
forme à simple chaîne. Tandis que la forme à simple chaîne
présente plusieurs avantages significatifs, on pense
généralement que beaucoup de parties non d'Immunoglobuline
15 comprises dans celle-ci exigent l'extrémité N-terminale native à
1'intérieur des molécules bifonctionnelles simple chaîne, afin
de conserver leur fonction. Par conséquent, le site de liaison
de l'antigène à 1 ' Ig à 1'intérieur d'une simple chaîne de ce
type doit être placé sur l'extrémité C-terminale. Cependant,
20 dans ces structures, l'activité de liaison de l'antigène sur la
position C-terminale est souvent perdue (voir exemple 8) . Cela
reste vrai même lorsque le système avantageux d'expression de
mammifère est utilisé. Il faut donc en conclure que 1'approche
de la simple chaîne ne fournit pas une forme généralement
25 applicable pour 1'expression fonctionnelle de structures
d'anticorps bifonctionnels.
Par conséquent, le problème technique à la base de la présente
invention consistait à développer une forme moléculaire pour
1'expression fonctionnelle de structures d'anticorps
30 bifonctionnels et multifonctionnels, qui est généralement
applicable aux combinaisons de n'importe quel fragment donné
d'anticorps scFv, éventuellement en combinaison avec différentes
portions non d'Immunoglobuline. La solution à ce problème
technique est obtenue par les modes de réalisation caractérisés
35 dans les revendications., 6
La présente invention concerne donc un composé multifonctionnel,
apte à être produit dans une cellule hôte de mammifère sous
forme d'un hétérodimère pouvant être sécrété et totalement
fonctionnel, formé de deux chaînes polypeptidiques, dans lequel
5 une desdites chaînes polypeptidiques comprend en tant que seul
domaine de la région constante d'une chaîne lourde d'une
Immunoglobuline le domaine CHi et l'autre chaîne polypeptidique
comprend le domaine CL constant d'une chaîne légère d'une
Immunoglobuline, dans lequel lesdites chaînes polypeptidiques
10 comprennent en outre au moins deux et jusqu'à quatre
(poly)peptides ayant des fonctions de récepteur ou de ligand
différentes, fusionnés avec lesdits domaines de région
constante, dans lequel, en outre, au moins deux desdits
(poly)peptides différents sont dépourvus d'une affinité
15 intrinsèque 1 * un pour 1'autre et dans lequel lesdites chaînes
polypeptidiques sont liées par 1 'intermédiaire desdits domaines
constants.
Le terme "composé multifonctionnel" tel qu'il est employé ici
signifie un composé comprenant deux chaînes polypeptidiques,
20 dans lequel ledit composé comprend au moins deux domaines
fonctionnels conférant des fonctions différentes. Les composés
multifonctionnels de ce type incluent par exemple les
hétérominibodies bi, tri ou tétraspécifiques. Le terme
"hétérominibody" signifie un hétérodimère formé de deux chaînes
25 polypeptidiques différentes, dans lequel les domaines qui
assurent la médiation de 1'hétérodimérisation sont composés
seulement des domaines Cm et CL de la région constante d'une
Immunoglobuline.
Le terme "domaines ayant une fonction de récepteur ou de ligand"
30 selon la présente invention signifie des domaines fonctionnels
comprenant une structure tridimensionnelle capable de lier
spécifiquement une molécule ou d'interagir avec celle-ci. Ces
molécules peuvent être, sans que ce soit limitatif, des peptides
ou polypeptides ainsi que leurs modifications post-
35 translationnelles. Ces modifications post-translationnelles7
comprennent, sans que ce soit limitatif, les glycosylations (N-
et/ou O-glycosylations), la sulfatation de la tyrosine, la
phosphorylation et/ou 1'hydroxylation de la proline.
Le terme "(poly)peptides différents sont dépourvus d'une
5 affinité intrinsèque 1'un pour 1'autre" signifie, selon la
présente invention, que des (poly)peptides différents n'ont pas
tendance naturellement à s'associer dans des conditions
physiologiques, comme le font par exemple les chaînes VH et VL.
Le terme "totalement fonctionnel" signifie, selon la présente
10 invention, que les composés selon 1'invention, sécrétés par des
cellules hôtes de mammifère dans le surnageant de la culture,
contrairement par exemple aux protéines exprimées sous forme de
corps d'inclusion dans E. coli, n'exigent pas de repliement des
protéines après purification ; toutes les sous-unités des
15 composés selon 1'invention sont correctement repliées et
expriment donc leurs fonctions spécifiques simplement en étant
exprimées dans des cellules hôtes de mammifère et sécrétées par
celles-ci.
La présente invention fournit donc un composé multifonctionnel
20 comprenant deux chaînes polypeptidiques différentes, dans lequel
1'hétérodimérisation efficace desdites chaînes polypeptidiques
durant 1'expression et le processus de sécrétion dans les
cellules hôtes de mammifère est à médiation par 1'interaction
des domaines de région constante, spécifiés précédemment, de
25 chaînes légères et lourdes d'une Immunoglobuline.
L'hétérodimérisation de domaines constants d'une Immunoglobuline
permet 1'interaction d'au moins deux chaînes (poly)peptidiques
différentes supplémentaires, fusionnées avec ces domaines,
dépourvues d'une affinité intrinsèque 1'une pour 1'autre dans un
30 seul système d'expression mammifère, en permettant également une
modification post-translationnelle adéquate et conduisant à un
composé pouvant être sécrété, de complexité structurelle plus
élevée.
Les domaines du composé multifonctionnel selon l'invention,
35 ayant une fonction de récepteur ou de ligand, peuvent être liéspar les extrémités C- et N-terminales d'un ou des deux domaines
constants d'Immunoglobuline. Par conséquent, la présente
invention fournit des composés multifonctionnels qui peuvent
comprendre des molécules bi, tri ou tétrafonctionnelles dans
5 lesquels chacune desdites fonctions de récepteur ou de ligand
peut être liée sur 1'extrémité C- ou N-terminale desdits
domaines constants d'Immunoglobuline.
La liaison desdits domaines fonctionnels aux domaines constants
d'Immunoglobuline peut être effectuée par exemple par génie
10 génétique, comme décrit dans les exemples. Les procédés de
préparation de chaînes polypeptidiques fusionnées et liées de
manière opérationnelle et de leur expression dans des cellules
de mammifère sont bien connus dans la technique (par exemple
Sambrook et coll., Molecular Cloning: A Laboratory Manual, Cold
15 Spring Harbor Laboratory Press, Cold Spring Harbor, New York,
1989).
Comme il a été détaillé précédemment, on a trouvé que la
solution aux divers problèmes traités dans 1'état de la
technique est une forme moléculaire composée de deux chaînes
20 polypeptidiques différentes, dans laquelle une chaîne
polypeptidique contient le domaine CHi d'une chaîne lourde d'une
Immunoglobuline et 1'autre chaîne polypeptidique contient le
domaine constant d'une chaîne légère d'une Immunoglobuline, en
assurant ainsi la médiation d'une hétérodimérisation efficace
25 desdites chaînes polypeptidiques durant le processus
d'expression et de sécrétion dans des cellules hôtes de
mammifère. Cette forme moléculaire fournit avantageusement deux
positions N-terminales contrairement à la forme à simple chaîne
de l'état de la technique et s'est révélée efficacement sécrétée
30 par les cellules hôtes de mammifère dans le surnageant de la
culture, où elle se trouve sous forme de protéine hétérodimère
totalement fonctionnelle et gycosylée de manière adéquate, qui
peut être facilement purifiée.
De plus, la forme moléculaire selon l'invention fournit deux
35 positions C-terminales qui peuvent être occupées par d'autresdomaines de protéine, en donnant ainsi un composé
multifonctionnel portant plus de deux entités fonctionnelles
différentes. Dans le cas où deux (poly)peptides différents qui
n'ont pas tendance à s'associer dans les conditions exposées
5 précédemment sont fusionnés sur les extrémités N-terminales des
domaines de région constante, une région VH et VL respectivement
peut être trouvée sur chaque extrémité C-terminale desdits
domaines de région constante. L'identification des domaines
appropriés d'hétérodimérisation qui répondent aux critères
10 mentionnés précédemment n'était pas une tâche banale, car les
stratégies pour obtenir 1'hétérodimérisation préférentielle,
dans les systèmes d'expression à un seul hôte, de préférence de
deux récepteurs ou ligands différents dépourvus d'une affinité
intrinsèque 1 ' un pour 1'autre, en utilisant les domaines
15 d'hétérodimérisation, ont échoué précédemment ou doivent encore
être développées. Il a été démontré que les domaines
d'hétérodimérisation basés sur les leucine zippers, par exemple,
facilitent l'hétérodimérisation, dans les systèmes d'expression
à un seul hôte, de chaînes polypeptidiques qui, bien que très
20 faiblement (Chang, Proc. Natl. Acad. Sei. ,USA 91 (1994), 11408-
11412 ; Kalandadze, J. Biol. Chem. 271 (1996), 20156-20162), ont
tendance intrinsèquement à s ' hétérodimériser 1'une avec 1'autre,
comme les chaînes a et ß des récepteurs de cellules T ou des II-
molécules de classe du CMH. Cependant, dans les cas de deux
25 protéines différentes dépourvues d'affinité intrinsèque 1'une
pour l'autre ou ayant une certaine affinité intrinsèque l'une
pour l'autre, mais sans préférence d'hétérodimérisation, comme,
par exemple, les deux sites différents de liaison d'antigène à
l'intérieur d'anticorps bispécifiques hétérodimères, les
30 domaines basés sur Jun et fos ont produit quantitativement des
homodimères au lieu d'hétérodimères dans des systèmes
d'expression à un seul hôte (de Kruif, J. Biol. Chem. 271
(1996) , 7630-7634) . Ces homodimères Jun et Fos ont pu être
dissociés in vitro, mélangés et soumis à des conditions
35 facilitant la réassociation, qui ont résulté principalement en10
hétérodimères Jun-Fos (Kostelny, J. Immunol. 14 8 (1992), 154 7-
1553) . Un exemple d'hétérodimérisation de protéines qui se
produit naturellement se trouve dans les immunoglobulines, où
des chaînes lourdes et légères s'associent pour former des sites
5 de liaison d'antigène. Dans la molécule d'anticorps,
1'hétérodimérisation des domaines de région variable VL et VH,
qui ont une affinité intrinsèque l'un pour l'autre, est
facilitée par les domaines de région constante CL et Cm. Ainsi,
il n'a pas été surprenant que CL et CHi aient pu soutenir aussi
10 la dimérisation des fragments scFv (Müller, FEBS Letters 422
(1998), 259-264), parce que les fragments scFv sont connus aussi
pour former des dimères 1 'un avec 1 'autre, même sans 1 'aide de
domaines spéciaux de dimérisation (Korff, Eur. J. Biochem. 221
(1994), 151-157 ; Griffiths, EMBO J. 12 (1993), 725-734). La
15 dimérisation autochtone de fragments scFv est très probablement
due à une rupture des plaques hydrophobes à 1'interface des
domaines variable/constant de 1'anticorps, conduisant à ce que
des résidus qui sont normalement enfouis dans des
immunoglobulines intactes ou fragments Fab soient exposés au
20 solvant (Nieba, Protein Eng. 10 (1997), 435-444). Ainsi, CL et
Chi selon 1'état de la technique, de manière similaire aux
domaines Jun et Fos, étaient connus pour favoriser le processus
de dimérisation autochtone de polypeptides ayant une affinité
intrinsèque 1 ' un pour 1'autre, en favorisant ainsi la formation
25 d'hétérodimère plutôt que d'homodimères. Cependant, 1'approche
selon la présente invention permet 1'hétérodimérisation de deux
chaînes (poly)peptidiques différentes dépourvues d'affinité
intrinsèque l'une pour l'autre, dans un système d'expression à
un seul hôte, dans lequel lesdits (poly)peptides sont fusionnés
30 avec lesdits domaines de région constante.
Ainsi, on a trouvé de manière surprenante que CL et CHi
(seulement par eux-mêmes) peuvent fournir des forces suffisantes
de dimérisation, capable de joindre différents récepteurs ou
ligands (par exemple CD80 et le fragment M79scFv, voir exemple
35 1) qui, normalement, ne s'associent absolument pas de manière11
autochtone ou peuvent même, dans une certaine mesure, résister à
1'hétérodimérisation pour des raisons stéréochimiques ou
thermodynamiques. Par conséquent, 1'approche selon la présente
invention permet 1'hétérodimérisation de deux chaînes
5 (poly)peptidiques différentes dépourvues d'affinité intrinsèque
l'une pour l'autre, dans un système d'expression à un seul hôte,
dans lequel lesdits (poly)peptides sont fusionnés avec lesdits
domaines de région constante. Cette approche, de manière très
importante, répond aux exigences d'expression fonctionnelle et
10 de sécrétion des cellules hôtes de mammifère, en permettant
ainsi des composés multifonctionnels (comme bi, tri ou
tétrafonctionnels) basés sur 1'hétérodimérisation, qui peuvent
être glycosylés et de complexité structurelle plus élevée.
L'identification des domaines d'oligomer!sation qui répondent
15 généralement aux exigences d'expression et de sécrétion des
cellules hôtes de mammifère n'était absolument pas évidente,
puisque la faisabilité de ces domaines dans des systèmes
d'expression bactérienne s'est révélée non prévisible dans les
cellules hôtes de mammifère. Les résultats indiqués par
20 1'exemple 9 illustrent cette contradiction générale.
Il a été trouvé de manière surprenante dans la présente
invention, comme le démontrent les exemples, que la formule
moléculaire de l'invention désignée par "hétérominibody" s'est
révélée capable de porter de nombreux polypeptides différents et
25 en nombres variables (jusqu'à 4) ayant une fonction de récepteur
ou de ligand, fusionnés avec les extrémités N- et/ou C-
terminales de CL ou CH1 sans perdre de leur aptitude à être
produites sous forme de molécule pouvant être sécrétée et
totalement fonctionnelle dans des cellules hôtes de mammifère.
30 Les dérivés bifonctionnels d'anticorps décrits dans les exemples
1-4 (dont les modes de réalisation correspondants sont décrits
plus loin) et produits selon la formule moléculaire selon
l'invention consistent en un fragment d'anticorps scFv dirigé
contre un antigène associé à une tumeur, par exemple 17-1A ou
35 Lewis Y, et la partie extracellulaire des récepteurs cellulaires12
(par exemple CD80, CD86, CD58, CD54) principalement exprimée sur
les cellules présentant un antigène, par exemple les cellules
dendritiques, et connues pour leur fonction de co-stimulation
et/ou d'adhérence des cellules T. L'un de ces dérivés
5 bifonctionnels d'anticorps, 1'hétérominibody M79scFvCK/CD80CHl,
a été soumis largement à des tests de son activité
fonctionnelle. La molécule recombinante a montré qu'elle se lie
sur son antigène cible natif 17-IA sur des cellules intactes et
a montré, de manière surprenante, qu'elle fournit ensuite non
10 seulement un signal co-stimulateur nécessaire aux lymphocytes T
naïfs en raison de son bras CD80 (B7-1) , mais qu'elle assure la
médiation d'une co-stimulation suffisante pour amorcer des
cellules T CD4 + et CD8+ naïves qui reçoivent en même temps le
signal d'activation primaire par 1 ' intermédiaire d'un anticorps
15 bispécifique simple chaîne anti-17-lA x anti-CD3 (Mack, Proc.
Natl. Acad. Sei. USA 92 (1995), 7021-7025), désigné également
par M79scFv-antiCD3scFv. Les phénomènes d'amorçage ont pu être
clairement démontrés en faisant passer le phénotype de surface
des cellules T de celui de lymphocytes T naïfs (CD4 5RA+R0-) à
20 celui de lymphocytes T amorcés (CD4 5RA-RO+) et ont pu être
confirmés par détermination des cytokines caractéristiques dans
le surnageant de cellules T. La sécrétion exclusive de INF-y,
mais non IL-5 et IL-4, par des lymphocytes T CD4+ amorcés in
vitro a également démontré, de manière intéressante, que
25 1'hétérominibody M79scFvCK/CD80CH.l assure sélectivement la
médiation de 1'amorçage et de la différenciation des cellules T
CD4+ qui expriment le phénotype THl, lequel est considéré comme
augmentant avantageusement la réponse immunitaire cellulaire
contre les cellules tumorales in vivo. Pour d'autres structures
30 bifonctionnelles B7 (CD80 ou CD86) spécifiques à des tumeurs,
décrites dans la littérature, il n'a pas encore été démontré
qu'elles fournissent une co-stimulation suffisante pour
l'amorçage des cellules T naïves (Gerstmayer, J. Immunol. 158
(1997), 4584-4590 ; Challita-Eid, J. Immunol. 160 (1998), 3419-
35 3426). On considère que ces structures d'hétérominibodies co-13
stimulateurs peuvent être appliquées in vivo seules ou en
combinaison avec un anticorps bispécifique qui fournit le signal
d'activation primaire des cellules T, indépendant du récepteur
clonotypique de cellule T. De plus, on considère que cette
5 combinaison peut être obtenue par combinaison structurelle des
caractéristiques des deux molécules à 1'intérieur d'un composé
multifonctionnel selon la formule moléculaire selon 1'invention,
comme décrit dans l'exemple 7 et indiqué par la figure 23.
En outre, la présente invention concerne un composé
10 multifonctionnel formé de deux chaînes polypeptidiques, dans
lequel une desdites chaînes polypeptidiques comprend en tant que
seul domaine de la région constante d'une chaîne lourde d ' une
Immunoglobuline le domaine CHi et 1'autre chaîne polypeptidique
comprend le domaine CL constant d'une chaîne légère d'une
15 Immunoglobuline, ledit composé multifonctionnel comprenant en
outre au moins deux (poly)peptides ayant des fonctions de
récepteur ou de ligand différentes, fusionnés avec lesdits
domaines de région constante, dans lequel, en outre, au moins
deux desdits (poly)peptides différents sont dépourvus d'une
20 affinité intrinsèque l'un pour l'autre et dans lequel lesdites
chaînes polypeptidiques sont liées par 1'intermédiaire desdits
domaines constants. De manière avantageuse, ledit composé
multifonctionnel peut être produit dans une cellule hôte de
mammifère sous forme d'un hétérodimère pouvant être sécrété et
25 totalement fonctionnel.
Dans un mode de réalisation préféré, le composé multifonctionnel
selon la présente invention comprend au moins trois domaines
fonctionnels, ayant une fonction de récepteur ou de ligand,
fournissant un hétérominibody trispécifique.
30 Dans un mode de réalisation plus préféré, le composé
multifonctionnel selon la présente invention comprend quatre
domaines, ayant une fonction de récepteur ou de ligand,
fournissant un composé multifonctionnel/hétérominibody avec des
domaines effecteurs présents dans les quatre positions. Un14
composé multifonctionnel de ce type peut être bi, tri ou
tétraspécifique.
La présente invention concerne aussi, dans un autre mode de
réalisation préféré, le composé multifonctionnel selon la
5 présente invention, dans lequel au moins deux domaines, ayant
une fonction de récepteur ou de ligand, sont liés par
l'intermédiaire de leur extrémité N-terminale auxdits domaines
constants CHi ou Ch. De plus, la présente invention concerne,
dans un autre mode de réalisation préféré, le composé
10 multifonctionnel selon l'invention, dans lequel au moins deux
domaines, ayant une fonction de récepteur ou de ligand, sont
liés par 1'intermédiaire de leur extrémité C-terminale auxdits
domaines CHi ou CL. Dans ce cas, Cm et/ou CL qui ne portent pas de
domaines de récepteur ou de ligand sur leur extrémité N-
15 terminale doivent porter un peptide leader sur 1'extrémité N-
terminale, dérivé de préférence de chaînes lourdes ou légère
d'Immunoglobuline, afin de faciliter la sécrétion par les
cellules hôtes de mammifère.
Tous les modes de réalisation précédents envisagent des composés
20 multifonctionnels/hétérominibody dans lesquels deux, ou plus,
domaines fonctionnels/ domaines effecteurs sont fusionnés par
leur extrémité N- ou C-terminale au même domaine constant (C) .
Par exemple, si chaque position N- et/ou C-terminale desdits
domaines C est occupée par un domaine effecteur/fonctionnel, un
25 ou plusieurs domaines effecteurs/fonctionnels supplémentaires
peuvent être fusionnés avec chacun desdits domaines effecteurs
dans ladite position. Un exemple de ce type de structure est
donné par la figure 52.
Dans le cas où des polypeptides ayant des fonctions de récepteur
30 ou de ligand sont constitués des parties extracellulaires des
protéines transmembranaires intégrales de type I ou type II, il
est préféré que les parties extracellulaires des protéines de
type I soient fusionnées à l'extrémité N-terminale de CL ou CH1 ,
tandis que les parties extracellulaires des protéines de type II15
sont fusionnées de préférence sur 1'extrémité C-terminale de CL
ou Chi-
Les polypeptides ayant des fonctions de récepteur ou de ligand
sont fusionnés de préférence sur 1'extrémité N- ou C-terminale
5 de CL ou Chi par l'intermédiaire de régions charnières d'Ig ou de
fragments de liaison peptidiques flexibles, par exemple par
l'intermédiaire d'un fragment de liaison glycine-sérine, afin
d'assurer la fonctionnalité desdits polypeptides. Des fragments
de liaison de différents types ou longueurs peuvent être
10 identifiés sans la contrainte excessive d'obtenir une activité
fonctionnelle totale de polypeptides spécifiques.
Dans un autre mode de réalisation préféré, 1'invention concerne
le composé multifonctionnel selon 1'invention, dans lequel au
moins un desdits domaines, ayant une fonction de récepteur ou de
15 ligand, est sous la forme d'un fragment scFV ou de l'une de ses
parties fonctionnelles.
Le composé multifonctionnel selon l'invention, dans lequel au
moins un desdits domaines, ayant une fonction de récepteur ou de
ligand, est un ligand co-stimulateur d'une cellule T, une région
20 de liaison à un antigène spécifique d'un antigène associé à une
tumeur, ou un composé protéinique fournissant le signal
d'activation primaire pour des cellules T, est un autre mode de
réalisation préféré de l'invention.
L'activation adéquate résultant en 1'amorçage de cellules T
25 naïves est critique pour les réponses immunitaires primaires et
dépend de deux signaux dérivés de cellules présentant un
antigène professionnel, comme des cellules dendritiques. Le
premier signal est spécifique d'un antigène et normalement à
médiation par stimulation du récepteur clonotypique d'antigène
30 de cellule T, qui est induite par 1'antigène traité, présenté
dans le contexte des molécules de classe I du CMH ou molécules
de classe II du CMH. Toutefois, ce stimulus primaire est
insuffisant pour induire des réponses d'amorçage des cellules T
naïves et il faut le second signal, lequel est fourni par une
35 interaction de molécules spécifiques de surface de cellules T,16
effectuant la liaison à des molécules de ligand co-stimulateur
sur des cellules présentant un antigène, en favorisant également
la prolifération de cellules T amorcées. Le terme "ligand co-
st imulateur de cellules T" signifie donc, à la lumière de la
5 présente invention, des molécules qui sont aptes à favoriser
l'amorçage de cellules T naïves en combinaison avec le stimulus
primaire et incluent, sans que ce soit limitatif, les éléments
de la famille B7 de protéines, notamment B7-1 (CD80) et B7-2
(CD86) .
10 Une région de liaison à un antigène spécifique à un antigène
associé à une tumeur signifie des fragments d'anticorps dirigés
contre un antigène associé à une tumeur, connu dans l'état de la
technique, par exemple 17-1A ou Lewis Y, Muc-1, erbB2 ou s-Tn.
A la lumière de la présente invention, "composés protéiniques
15 fournissant le signal d'activation primaire pour des cellules T"
peut comprendre, sans que ce soit limitatif, des fragments svFv
anti-CD3, des fragments svFv de récepteur anti-cellules T ou des
superantigènes. Les superantigènes se lient directement à
certaines sous-familles de régions variables de récepteurs de
20 cellules T d'une manière indépendante de la cellule hôte de
mammifère, en produisant ainsi la médiation du signal
d'activation primaire pour des cellules T.
De plus, dans un autre mode de réalisation préféré, 1'invention
concerne le composé multifonctionnel selon 1 * invention, dans
25 lequel ledit fragment scFv ou ladite partie fonctionnelle de
celui-ci comprend les régions VH et VL de l'anticorps murin anti-
17-1A (Gôttlinger, Int. J. Cancer 38 (1986), 47), les régions VH
et VL de l'anticorps anti-Lewis Y, représentées sur la figure 6,
et les régions VH et VL de l'anticorps anti-CD3 TR66 (Traunecker,
30 EMBO J. 10 (1991) 3655) et/ou les régions VH et VL de l'anticorps
humain anti-EpCAM humaine, représentées sur la figure 55 (basée
sur l'anticorps humain anti-EpCAM humaine "HD70" décrit dans le
document WO 98/46645).
Dans un mode de réalisation plus préféré, l'invention concerne
35 le composé multifonctionnel selon 1'invention, dans lequel le17
ligand co-stimulateur des cellules T est une molécule de surface
cellulaire ou un de ses fragments, exprimée sur des cellules
présentant un antigène.
Dans un mode de réalisation encore plus préféré, le composé
5 multifonctionnel selon 1'invention comprend une cellule
présentatrice d'antigène qui est une cellule dendritique.
De plus, dans un mode de réalisation très préféré, la présente
invention concerne le composé multifonctionnel selon
1'invention, dans lequel la molécule de surface cellulaire sur
10 une cellule présentatrice d'antigène est un facteur co-
stimulateur des cellules T tel que B7-1 (CD80) ou B7-2 (CD86) ,
ou des protéines d'adhérence comme LFA-3 (CD58), ICAM-1 (CD54),
ICAM-2 ou ICAM-3, ou comme le ligand CD137.
Le composé multifonctionnel selon 1'invention, dans lequel au
15 moins un desdits domaines ayant une fonction de récepteur ou de
ligand est une molécule effectrice immuno-modulatrice ou un de
ses fragments, est encore un autre mode de réalisation préféré
de 1'invention. Une molécule effectrice immuno-modulatrice
influence positivement et/ou négativement le système immunitaire
20 humoral et/ou cellulaire, en particulier ses composantes
cellulaires et/ou non cellulaires, ses fonctions et/ou ses
interactions avec d'autres systèmes physiologiques.
Dans un mode de réalisation encore plus préféré, ladite molécule
effeetrice immuno-modulatrice est choisie dans le groupe
25 consistant en cytokines, chemokines, facteur inhibiteur de
migration des macrophages (MIF, tel que décrit, entre autres,
dans Bernhagen (1998), Mol Med 76 (3-4), 151-161 ou Metz (1997),
Adv Immunol 66, 197-223), récepteurs de cellules T et molécules
solubles du CMH. Ces molécules effectrices immuno-modulatrices
30 sont bien connues dans 1 'état de la technique et sont décrites,
entre autres, dans Paul, "Fundamental immunology", Raven Press,
New York (1989) . En particulier, les cytokines et chemokines
connues sont décrites dans Meager, "The Molecular Biology of
Cytokines" (1998), John Wiley & Sons, Ltd., Chichester, West
35 Sussex, Angleterre ; (Bacon (1998). Cytokine Growth Factor Rev9(2):167-73 ; Oppenheim (1997). Clin Cancer Res 12, 2682-6 ;
Taub (1994) Ther Immunol 1(4), 229-46 ou Michiel (1992). Semin
Cancer Biol 3(1),3-15).
Les cytokines particulièrement préférées sont celles qui sont
5 choisies dans le groupe consistant en interleukine(s),
interferon(s), TNFs et VEGF (Veikkola Semin Cancer Biol 9(3),
211-20), dans lesquelles lesdites interleukine(s) comprennent,
sans que ce soit limitatif, IL-la, IL-2, IL-3, IL-4, IL-5, IL-6,
IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-
IO 16, IL-17 et IL-18, dans lesquelles les interferon(s)
comprennent IFN-y ainsi que IFN-ß et IFN-a et dans lesquelles les
TFNs comprennent des éléments de la superfamille de
lymphotoxines, tels que TNF-a et TNF-ß (Gruss (1996) Int J Clin
Lab Res 26(3}, 143-59). D'autres cytokines adéquates sont bien
15 connues dans 1'état de la technique et comprennent, entre
autres, GM-CSF, G-CSF, M-CSF. Dans un mode de réalisation
particulièrement préféré, ladite molécule effectrice immuno-
modulatrice est une chémokine et est choisie dans le groupe
consistant en IL-8, eotaxine, GROa, GROß, GROy, IP-10, MCP-1,
20 MCP-2, MCP-3, MCP-4, MIG, MIP-la, MIP-lß, NAP-2, RANTES, 1309,
lymphotactine, SDF-1 et C5a.
Le cadre de la présente invention comprend aussi d'autres
composés multifonctionnels, dans lesquels lesdits domaines
comprennent, entre autres, différentes molécules effectrices
25 immuno-modulatrices, éventuellement en combinaison avec des
domaines qui sont sous la forme d'un ou de fragments scFv. Les
composés multifonctionnels particulièrement préférés sont ceux
qui peuvent comprendre un hétérominibody avec cytokines liées
par l'extrémité C-terminale, comme IL-2 et GM-CSF, et les scFv
30 liés par 1'extrémité N-terminale reconnaissant, par exemple,
EpCAM, comme 1'illustrent les exemples joints. Ces molécules ne
sont pas limitées à l'activation des cellules effectrices qui
sont spécifiquement activées par une seule cytokine. Par
addition de deux domaines fonctionnels ayant une fonction de
35 ligand et comprenant deux cytokines différentes, ce composé19
multifonctionnel peut être utile dans 1'activation d'une gamme
plus large de cellules effectrices dans un milieu tumoral. Ces
cellules effectrices peuvent être stimulées pour évoquer une
réponse immunitaire contre les cellules tumorales
5 (environnantes) et/ou les cellules atteintes par la croissance
de cellules malignes. Ces structures conservent leurs propres
activités biologiques, comme 1'illustre 1'exemple 11, et peuvent
trouver une application dans le traitement et/ou la prévention
de la croissance de cellules malignes.
10 Dans un autre mode de réalisation préféré, la présente invention
concerne le composé multifonctionnel selon 1'invention, dans
lequel au moins un desdits domaines ayant une fonction de
récepteur ou de ligand est un ligand FAS (CD95L) ou un de ses
fragments. Le ligand FAS (CD95L) est bien connu dans 1 ' état de
15 la technique et est décrit, entre autres, dans Janeway and
Travers, "Immunologie", Spektrum Verlag Heidelberg, Berlin,
Oxford (1997).
De plus, dans un autre mode de réalisation préféré, la présente
invention concerne le composé multifonctionnel selon
20 1'invention, dans lequel ledit domaine ayant une fonction de
récepteur ou de ligand est un facteur de croissance ou un de ses
fragments. Ledit facteur de croissance peut être également un
facteur de croissance modifié ayant une activité de liaison avec
son récepteur approprié, mais peut fonctionner en tant
25 qu'antagoniste. Comme beaucoup de tumeurs ou d'autres cellules
(qui peuvent être des cibles pour les composés multifonctionnels
décrits ici) expriment des récepteurs pour facteurs de
croissance sur leur surface, ce type de molécule peut être utile
pour le ciblage. Les facteurs de croissance comprennent, sans
30 que ce soit limitatif, les ligands EGF (facteur de croissance
épidermique) de la famille de récepteurs ErbB, MSH, interleukine
1 (IL-1). De plus, les facteurs de croissance et leurs
modifications sont connus dans 1'état de la technique et
décrits, entre autres, dans Gullick (1996) Cancer Surv. 27, 339-
35 49 ; Siegall (1996) Recent Results Cancer Res 140, 51-60 ;20
Carrithers 1996 Chem Biol 3(7), 537-42 ou Bresnihan (1998) Rheum
Dis Clin Norh Am 24(3) ; 615-28.
De plus, dans un mode de réalisation très préféré, la présente
invention concerne le composé multifonctionnel selon
5 1'invention, dans lequel ledit domaine ayant une fonction de
récepteur ou de ligand est un inhibiteur de 1'angiogénèse (tel
que défini entre autres dans Malonne (1999) Clin Exp Metastasis
17(1), 1-14 ; Veikkola (1999) Semin Cancer Biol 9(3), 211-20 ;
Desa (1999), J Immunother 22 (3), 186-211 ; Strohmeyer (1999)
10 Anticancer Res 19 (2C), 1557-61 ; Folkman (1995) Nat Med 1(1),
27-31) ou un de ses fragments.
De préférence, le composé multifonctionnel selon 1'invention
comprend des domaines fonctionnels ayant une fonction de
récepteur ou de ligand qui sont d'origine mammifère. De manière
15 très préférable, lesdits domaines fonctionnels sont d'origine
humaine.
Le composé multifonctionnel selon 1'invention dans lequel ledit
domaine constant d'une chaîne légère d'Immunoglobuline est de
type k constitue un autre objet de la présente invention.
20 Eventuellement, le domaine constant d'une chaîne légère d'une
Immunoglobuline peut être de type X.
Dans un autre mode de réalisation, la présente invention
concerne le composé multifonctionnel selon 1'invention, dans
lequel lesdits domaines constants d'immunoglobuline et les
25 domaines fonctionnels récepteur-ligand décrits précédemment sont
reliés au moyen d'un fragment de liaison polypeptidique. Ce
fragment de liaison polypeptidique, disposé entre les domaines
d'immunoglobuline et les domaines fonctionnels récepteur-ligand
comprend de préférence des acides aminés multiples, hydrophiles,
30 liés à des peptides, qui sont liés par covalence à ces domaines.
Dans un mode de réalisation plus préféré, ledit fragment de
liaison polypeptidique comprend une région charnière d'Ig ou
plusieurs glycines, alanines et/ou serines.
Dans un mode de réalisation particulièrement préféré, ladite
35 région charnière d'Ig et une région charnière d'IgG.21
Dans un mode de réalisation très préféré, la région charnière
d'IgG est une région charnière supérieure d'IgG3 humaine.
De préférence, le composé multifonctionnel selon 1'invention
comprend un composé multifonctionnel, dans lequel lesdits
5 domaines fonctionnels ayant une fonction de récepteur ou de
ligand comprennent GM-CSF, IL-2 et/ou un (des) fragments scFv
comprenant les régions VH et VL de 1'anticorps humain anti-EpCAM
humaine, tel que représenté à la figure 55. De préférence,
lesdits GM-CSF et IL-2 sont liés par 1 ' intermédiaire de leur
10 extrémité C-terminale auxdits domaines CHi ou CL et le(s) dit(s)
fragment(s) scFv comprenant les régions VH et VL de 1'anticorps
humain anti-EpCAM humaine est(sont) lié (s) par 1'intermédiaire
de leur extrémité N-terminale auxdits domaines constants CHi ou
CL-
15 De manière très préférable, lesdits GM-CSF et IL-2 sont
d'origine humaine. Un composé multifonctionnel de ce type est
particulièrement adéquat pour des buts thérapeutiques et
diagnostic. Ce composé multifonctionnel, comprenant GM-CSF, IL-2
et lesdits fragments scFv comprenant les régions VH et VL de
20 1'anticorps humain anti-EpCAM humaine, est représenté à la
figure 53. Si 1'on considère que, dans ce composé
multifonctionnel, tous les domaines ayant une (des) fonction(s)
de récepteur ou de ligand ainsi que les domaines
d'hétérodimérisation sont d'origine humaine, il peut être d'une
25 valeur spécifique et spéciale pour le traitement ou la
prévention de la croissance de cellules malignes. Un composé
multifonctionnel de ce type est potentiellement moins immunogène
qu'une molécule similaire contenant des domaines provenant
d'autres espèces. IL-2 d'origine humaine et GS-CSF d'origine
30 humaine sont, dans ce contexte, particulièrement utiles, puisque
ces cytokines sont capables de stimuler une gamme large et
surtout différente de cellules effectrices. Une structure, telle
que représentée à la fig. 53, est particulièrement utile dans le
traitement de la croissance de cellules malignes, spécialement
35 pour le traitement de tumeurs solides, comme des carcinomes.22
Dans un autre mode de réalisation préféré, la présente invention
concerne le composé multifonctionnel selon 1'invention, dans
lequel ledit domaine CHi comprend également une étiquette
histidine, GST, une étiquette de protéine A de Staphylococcus,
5 Lex A, une étiquette FLAG ou une étiquette MYC. Ces séquences
additionnelles, capables de se lier sélectivement à un support
solide ou d'être utilisées dans des buts de purification,
peuvent être des séquences de polypeptides de longueur totale ou
des fragments de celles-ci. Du fait que ces étiquettes sont
10 fusionnées avec le domaine CHi, le composé multifonctionnel
complet peut être isolé de manière conventionnelle.
En outre, la présente invention concerne un composé
multifonctionnel dans lequel lesdits domaines fonctionnels ayant
une fonction de récepteur ou de ligand sont ou sont dérivés d'un
15 domaine non-immunoglobuline. Le terme "dérivés de" signifie dans
ce conteste que la molécule d'acide aminé dudit domaine non-
immunoglobuline peut comprendre une (des) substitution(s),
suppression(s) , addition(s) , inversion(s), duplication(s) ,
recombinaison(s), etc.
20 Indépendamment de cela, la présente invention concerne aussi un
polynucleotide codant pour une et/ou les deux chaînes
polypeptidiques du composé multifonctionnel tel que défini
précédemment.
Ledit polynucleotide peut être fusionné avec des séquences
25 adéquates de contrôle de 1 'expression connues dans 1'état de la
technique pour assurer la transcription et la translation
appropriées des chaînes polypeptidiques. Ledit polynucleotide
peut être, par exemple, ADN, cADN, ARN, ou ADN ou ARN produits
synthétiquement, ou une molécule chimère d'acide nucléique
30 produite par recombinaison, comprenant 1 ' un quelconque de ces
polynucleotides soit seul soit en combinaison. De préférence,
ledit polynucleotide fait partie d'un vecteur. Ces vecteurs
peuvent comprendre d'autres gènes, tels que des gènes marqueurs
qui permettent la sélection dudit vecteur dans une cellule hôte
35 adéquate et dans des conditions adéquates. De préférence, le23
polynucleotide selon l'invention est lié de manière
opérationnelle aux séquences de contrôle de l'expression,
permettant 1'expression dans des cellules eucaryotes.
L'expression dudit polynucleotide comprend la transcription du
5 polynucleotide dans un mARN traduisible. Les éléments
régulateurs assurant 1 'expression dans des cellules eucaryotes,
de préférence des cellules de mammifère, sont bien connus des
spécialistes en la matière. Ils comprennent habituellement des
séquences régulatrices assurant 1 ' initiation de la transcription
10 et, éventuellement, des signaux poly-A assurant la terminaison
de la transcription et la stabilisation du transcript. Des
éléments régulateurs additionnels peuvent inclure des
stimulateurs de la transcription ainsi que de la traduction
et/ou des régions de promoteurs associées naturellement ou
15 hétérologues. Les éléments régulateurs possibles permettant
l'expression dans les cellules hôtes de mammifère comprennent le
promoteur CMV-, SV40, RSV (virus du sarcome de Rous), le
promoteur la du facteur humain d'elongation, le stimulateur CMV
ou stimulateur SV40. A côté des éléments qui sont responsables
20 de 1'initiation de la transcription, ces éléments régulateurs
peuvent également comprendre des signaux de terminaison de la
transcription, tels que le site SV40-poly-A ou le site tk-poly-
A, en aval du polynucleotide. Dans ce contexte, les vecteurs
adéquats de 1'expression sont connus dans la technique, comme le
25 vecteur pcDVl (Pharmacia) d'expression de cADN Okayama-Berg,
pCDM8, pRc/CMV, pcDNAl, pcDNA3 (in vitrogène), pSPORTl (GIBCO
BRL), pEF-DHFR (Mack, PNAS 92 (1995), 7021-7025). De préférence,
les séquences de contrôle de l'expression sont des systèmes de
promoteurs eucaryotes dans des vecteurs capables de transformer
30 ou de transfecter des cellules hôtes de mammifère. Une fois que
le vecteur a été incorporé dans l'hôte approprié, l'hôte est
maintenu dans des conditions adéquates pour 1'expression à
niveau élevé des séquences de nucleotides et, si on le désire,
le recueil et la purification du polypeptide selon 1'invention
35 peuvent suivre.24
Un vecteur comprenant au moins un des polynucleotides mentionnés
précédemment représente un autre objet de la présente invention.
Le vecteur selon la présente invention peut être, par exemple,
un plasmide, cosmide, virus, bacteriophage ou un autre vecteur
5 utilisé de manière conventionnelle dans le génie génétique, et
peut comprendre d'autres gènes, tels que des gènes marqueurs,
qui permettent la sélection dudit vecteur dans une cellule hôte
adéquate et dans des conditions adéquates.
Dans un autre mode de réalisation, la présente invention
10 concerne une cellule hôte de mammifère comprenant au moins un
vecteur selon la présente invention.
Dans un mode de réalisation préféré, la cellule hôte de
mammifère selon 1'invention est une cellule CHO ou une cellule
de myélome.
15 De plus, la présente invention concerne une méthode de
production du composé multifonctionnel selon 1'invention, ce
procédé comprenant la culture de la cellule hôte selon
1'invention dans des conditions qui permettent la synthèse dudit
composé multifonctionnel, et la récupération dudit composé
20 multifonctionnel à partir de la culture.
La présente invention permet donc la production recombinante de
composés multifonctionnels comprenant des sites et domaines de
ligands co-stimulateurs des cellules T, des régions de liaison à
un antigène spécifique pour un antigène associé à une tumeur ou
25 des composés protéiniques fournissant les premiers signaux
d'activation pour les cellules T. Comme il est évident d'après
ce qui précède, 1'invention fournit une vaste famille de
composés multifonctionnels comprenant des fonctions de
récepteur-ligand, pour tout usage dans des approches de
30 thérapeutique et de diagnostic. Il sera apparent pour les
spécialistes en la matière que les composés multifonctionnels
selon 1'invention peuvent être également couplés à d'autres
groupements pour, par exemple, cibler des médicaments ou pour
des applications d'imagerie pour le diagnostic. Ce couplage peut
35 être réalisé chimiquement après l'expression du composé25
multifonctionnel ou après 1'expression des chaînes
polypeptidiques selon l'invention, ou le produit du couplage
peut être traité dans les polynucleotides selon 1'invention,
comme discuté précédemment. Les polynucleotides sont alors
5 exprimés dans un système hôte approprié et les composés
multifonctionnels exprimés sont recueillis et purifiés, si
nécessaire.
Dans un autre mode de réalisation, la présente invention
concerne une composition comprenant le composé multifonctionnel
10 selon 1'invention, le polynucleotide selon 1'invention et/ou le
vecteur selon 1'invention et, éventuellement, un composé
protéinique capable de fournir le signal d'activation primaire
pour des cellules T. De manière très préférable, ladite
composition est une composition pharmaceutique comprenant en
15 outre, éventuellement, un support pharmaceutiquement acceptable
et /ou un diluant et/ou excipient. Selon la présente invention,
les composés protéiniques capables de fournir le signal
d'activation primaire pour des cellules T dans des compositions
pharmaceutiques et/ou compositions de diagnostic sont des
20 anticorps monospécifiques ou bispécifiques interagissant avec le
complexe CD-3, le récepteur de cellules T ainsi que des composés
incluant un superantigène.
Une composition de diagnostic comprenant le composé
multifonctionnel selon 1 ' invention, le polynucleotide selon
25 l'invention et/ou le vecteur selon l'invention et,
éventuellement, un composé protéinique capable de fournir le
signal d'activation primaire pour des cellules T ainsi que,
éventuellement, des moyens appropriés à la détection, représente
également un objet de la présente invention.
30 Dans un autre mode de réalisation préféré, la présente invention
concerne 1'utilisation du composé multifonctionnel selon
l'invention; le polynucleotide selon l'invention et/ou le
vecteur selon 1'invention pour la préparation d'une composition
pharmaceutique pour la prévention et/ou le traitement de la
35 croissance de cellules malignes.26
Dans un mode de réalisation particulièrement préféré, la
présente invention concerne l'utilisation indiquée précédemment,
dans laquelle la croissance de cellules malignes est liée à des
états malins des cellules hématopoïétiques ou à des tumeurs
5 solides.
Dans un mode de réalisation encore plus préféré, la présente
invention concerne 1'utilisation de 1'invention, dans laquelle
lesdits états malins des cellules hématopoïétiques sont des
lymphomes ou des leucémies.
10 Dans un mode de réalisation très préféré, la présente invention
concerne 1'utilisation de la présente invention, dans laquelle
lesdites tumeurs solides sont des carcinomes, des mélanomes ou
des sarcomes.
Un kit comprenant le composé multifonctionnel selon 1'invention
15 et, éventuellement, un composé protéinique capable de fournir le
signal d'activation primaire pour des cellules T représente
également un objet de la présente invention.
Dans un autre mode de réalisation préféré, la présente invention
concerne la composition pharmaceutique selon 1'invention, la
20 composition de diagnostic selon 1'invention ou le kit selon
1'invention, dans lesquels le composé protéinique capable de
fournir le signal d'activation primaire pour des cellules T est
un anticorps bispécifique interagissant avec 1'antigène CD3 des
cellules T.
25 La composition pharmaceutique selon la présente invention peut
comprendre, en outre, un support pharmaceutiquement acceptable,
des diluants et des excipients. Des exemples de supports, de
diluants et d'excipients pharmaceutiquement acceptables sont
bien connus dans la technique et incluent les solutions salines
30 tamponnées par un phosphate, 1'eau, les emulsions, telles que
les emulsions huile/eau, divers types d'agents mouillants, les
solutions stériles, etc. Les compositions comprenant ces
supports peuvent être formulées par les méthodes
conventionnelles bien connues. Ces compositions pharmaceutiques
35 peuvent être administrées au sujet à une dose appropriée. Le27
composé protéinique pharmaceutiquement actif peut être présent
en des quantités entre 1 ng et 10 mg par dose. L'administration
des compositions adéquates peut être effectuée par différentes
voies, par exemple par administration intraveineuse,
5 intraperitoneale, sous-cutanée, intramusculaire, topique ou
intradermique. La posologie sera déterminée par le médecin
traitant et par d'autres facteurs cliniques. Comme c'est bien
connu dans la science médicale, la posologie pour un patient
dépend de nombreux facteurs, incluant la taille du patient, sa
10 surface corporelle, son âge, le composé particulier à
administrer, le sexe, le moment et la voie d'administration, la
santé générale et les autres médicaments administrés
simultanément.
Dans toute cette description et les revendications qui suivent,
15 sauf si le contexte 1'exige autrement, le terme "comprennent" et
les variations telles que "comprend" et "comprenant" doivent
être interprétés comme impliquant 1'inclusion d'un nombre entier
indiqué ou un stade ou un groupe de nombres entiers ou de
stades, mais non l'exclusion de tout autre nombre entier ou
20 stade ou groupe de nombres entiers ou de stades.
Les figures représentent :
La figure 1 : la conception moléculaire de 1'hétérominibody
M79scFvCHl/CD80CK représenté au niveau de protéine. CHi et CK
indiquent le premier domaine constant de la chaîne lourde d'IgGl
25 humaine et la région constante de la chaîne légère d'Ig-kappa
humaine respectivement, qui forment ensemble l'unité
d'hétérodimérisation, réunies par covalence par un pont
disulfure (S-S). VH indique la région variable de la chaîne
lourde d'Ig et VL la région variable de la chaîne légère d'Ig.
30 (B-J) Conception moléculaire d'hétérominibody (B)
M79scFvCK/CD80CHl (C) M79scFvCK/CD54CK (D)
M79scFvCK/CD54CHl (E) M79scFvCK/CD58CK (F)
M7 9scFvCK/CD58CHl (G) M79scFvCK/CD86CK (H)
M79scFvCK/CD86CHl (I) antiLeyscFvCHl/CD80CK (J)28
antiLeyscFvCK/CD80CHl représenté au niveau protéine. Pour les
détails, voir la légende de la fig. 1(A).
La figure 2 : une séquence d'ADN désignée par CTI qui a été
clonée dans le site de clonage multiple du vecteur Bluescript KS
5 (numéro d'accès à la GenBank X52327) en utilisant les sites de
restriction Xbal et Sali afin d'augmenter le nombre de sites de
clonage possibles. Des sites de restriction dérivés de CTI, à
clivage par enzymes, sont représentés.
La figure 3 : la conception moléculaire de fragments d'ADN
10 codant pour les simples chaînes polypeptidiques d'hétérominibody
(A) M79scfvCHl/CD80CK (B)
M7 9scFvCK/CD80CHl (C) M79scFvCK/CD54CK (D)
M79scFvCK/CD54CHl (E) M7 9scFvCK/CD58CK (F)
M79scFvCK/CD58CHl (G) M79scFvCK/CD86CK (H)
15 M7 9scFvCK/CD86CHl (I) antiLeyscFvCHl/CD80CK (J)
antiLeyscFvCK/CD80CHl
Il faut noter que certains hétérominibodies ont la même chaîne
polypeptidique ; dans ces cas, les chaînes polypeptidiques
correspondantes sont représentées seulement une fois. Les
20 symboles sont utilisés comme sur les figures 1 (A) et 1 (B) , le
vecteur d'expression pEF-DHFR ou pEF-ADA est utilisé pour le
clonage et l'expression des chaînes individuelles est indiquée.
LewisY est abrégé sous forme de Ley.
La figure 4 : 1'analyse par test ELISA (test d'immunosorbent
25 lié à une enzyme) de surnageants de cultures cellulaires obtenus
à partir de cellules CHO transfectées avec le plasmide
d'expression pEF-DHFR-M79 scFv-CK pEFADA/CD80-CHl après
différents stades d'amplification et après sous-clonage. Des
plaques ELISA 96 puits ont été incubées avec 50 u.1 d'antigène
30 17-1A soluble (50 ug/ml) par puits. Ensuite, un surnageant pur
de culture cellulaire a été ajouté comme indiqué. La détection a
été effectuée au moyen d'un anticorps anti CK humain étiqueté
par biotine (Pierce, Cat N° 31780) , dilué à 1/1000 et par de
l'avidine conjuguée avec de la peroxydase (Dako, Hambourg Cat.
35 n° P0347) diluée à 1/1000. Pour le contrôle négatif, les puits29
ont été incubés avec une solution saline tamponnée par
phosphate. Le test ELISA a été développé par solution de
substrat ABTS, comme décrit dans l'exemple 2.1. Les valeurs de
la densité optique ont été mesurées à 4 05nm au moyen d'un
5 lecteur ELISA.
La figure 5 : l'analyse FACS d'hétérominibody M79scFvCK/CD80-
CH1 effectuant la liaison avec des cellules CHO transfectées par
17-1A. 200.000 cellules CHO transfectées par 17-1A (voir exemple
5.2) ont été incubées pendant 30 minutes avec plusieurs
10 dilutions d'hétérominibody M79scFvCK/CD80-CHl, allant de 4 ug/ml
à 3,9 ng/ml. Ensuite, les cellules ont été lavées deux fois dans
une solution saline tamponnée par phosphate et incubées pendant
30 minutes avec un anticorps murin anti CD80 humain, conjugué
avec R-phycoérythrine (Becton Dickinson Immunocytometry Systems,
15 San Jose CA, USA, Cat n° 340294). Après deux stades de lavage
final dans une solution saline tamponnée par phosphate, les
cellules ont été analysées par cytométrie en flux (FACS-SCAN
Becton Dickinson Immunocytometry Systems, San Jose CA, USA).
La figure 6 : une séquence d'ADN ainsi que d'acide aminé de
20 fragment antiLewisY scFv portant une séquence leader sur son
extrémité N-terminale. Les nucleotides de 68 à 394 codent pour
la région variable de la chaîne légère d'Ig, les nucleotides de
440 à 793 codent pour le domaine variable de la chaîne lourde
d'Ig. Les sites de clivage par enzymes de restriction importants
25 pour le clonage sont indiqués.
La figure 7 : l'analyse par test ELISA de surnageants de
cultures cellulaires obtenus à partir de deux transfectants
différents de cellules CHO, doublement transfectées avec soit
les plasmides d'expression pEF-DHFR-anti-Lewis Y-scFv-CK et pEF-
30 ADA-CD80-CH1 soit avec pEF-DHFR -CD80-CK et pEF-ADA anti-Lewis
Y- scFv-CHl après le premier stade d'amplification du gène,
respectivement. Des plaques ELISA 96 puits ont été incubées avec
50 ul de conjugué soluble de Lewis Y/sérum-albumine bovine (30
ug/ml) par puits. Ensuite, le surnageant pur de culture
35 cellulaire a été ajouté comme indiqué. La détection a été30
effectuée au moyen d'un anticorps monoclonal spécifique à CD80
(Immunotech, Cat N° 1449) dilué à 1/1000 et d'un anticorps
polyclonal de chèvre anti IgG de souris (spécifique Fc) conjugué
à de la peroxydase (Dianova Hambourg) dilué à 1/5000. Pour le
5 contrôle négatif, les puits ont été incubés avec une solution
saline tamponnée par phosphate. Le test ELISA a été développé
par solution de substrat ABTS, comme décrit dans l'exemple 2.1.
Les valeurs de la densité optique ont été mesurées à 405 nm au
moyen d'un lecteur ELISA. LeY est utilisé comme abréviation
10 d'anti-Lewis Y scFv.
La figure 8 : 1'analyse par test ELISA de surnageants de
cultures cellulaires obtenus à partir de deux transfectants
différents de cellules CHO, doublement transfectées avec soit
les plasmides d'expression pEF-DHFR-anti-Lewis Y-scFv-CK et pEF-
15 ADA-CD80-CH1 soit avec pEF-DHFR -CD80-CK et pEF-ADA anti-Lewis Y
scFv-CHl après le premier stade d'amplification du gène,
respectivement. Des plaques ELISA 96 puits ont été incubées avec
50 ni d'anticorps à étiquette anti his (25 jug/ml) sans sérum-
albumine bovine par puits. Ensuite, le surnageant pur de culture
20 cellulaire a été ajouté comme indiqué. La détection a été
effectuée par un anticorps anti CK humain étiqueté par biotine
(Pierce, Cat N° 31780), dilué à 1/1000 et par de l'avidine
conjuguée avec de la peroxydase (Dako, Hambourg Cat. n° PO347)
diluée à 1/1000. Pour le contrôle négatif, les puits ont été
25 incubés avec une solution saline tamponnée par phosphate. Le
test ELISA a été développé par solution de substrat ABTS, comme
décrit dans l'exemple 2.1. Les valeurs de la densité optique ont
été mesurées à 405nm au moyen d'un lecteur ELISA. LeY est
utilisé comme abréviation d'anti-Lewis Y scFv.
30 La figure 9 : test ELISA sur surnageant de culture cellulaire
des deux versions d'hétérominibody CD80, CD86, CD58, CD54
(détection spécifique).
La liaison à l'antigène 17-1A a été analysée au moyen de
l'antigène 17-1A recombinant, obtenu par expression stable dans
35 des cellules CHO, telles qu'elle est décrite (Mack et coll.31
Proc. Natl. Acad. Sei. 92 (1995)7021-7025 et exemple 4.4) .
L'antigène a été immobilisé sur les plaques ELISA 96 puits à
fond en U (Nunc maxisorb) à une concentration de solution saline
tamponnée par phosphate de 50 (il/ml. Le recouvrement a été
5 effectué à 4°C pendant 12 heures avec 50 fil, suivi par un lavage
une fois avec Tween à 0,05 % (solution saline tamponnée par
phosphate). Le test ELISA a ensuite été bloqué pendant 1 heure
avec solution saline tamponnée par phosphate contenant 3% de
sérum-albumine bovine, et lavé encore une fois. Ensuite, le
10 surnageant de culture cellulaire a été ajouté non dilué et à
plusieurs dilutions (pur, 1/2, 1/4, 1/8, 1/16, 1/32) et incubé
pendant 2 heures. La détection spécifique était fonction du type
de protéines co-stimulatrices associées avec les différentes
versions d'hétérominibody. Les anticorps spécifiques anti CD54,
15 anti CD58, anti CD80 et anti CD86 ont tous été utilisés dilués à
1/1000 (voir détails sur tableau 4.4). Après lavage trois fois
avec la solution saline tamponnée par phosphate Tween20 à 0,05
%, un anticorps polyclonal de chèvre anti IgG de souris
(spécifique Fc) conjugué à de la peroxydase (Dianova Hambourg),
20 dilué à 1/5000, a été ajouté et incubé à la température ambiante
pendant une heure. Après lavage quatre fois avec la solution
saline tamponnée par phosphate Tween20 à 0,05 %, le test ELISA a
été finalement développé en ajoutant le substrat ABTS comme
décrit dans 1'exemple 4.4. Pour le contrôle négatif, les plaques
25 ont été incubées avec la solution saline tamponnée par phosphate
au lieu de structures d'hétérominibody. Le précipité coloré a
été mesuré à 405 nm au moyen d'un lecteur ELISA.
La figure 10 : test ELISA sur surnageant de culture cellulaire
des deux versions d'hétérominibody CD80, CD8 6, CD58, CD54
30 (détection anti Ckappa humaine).
Un anticorps anti étiquette histidine (DIANOVA, Hambourg Cat N°
DIA 910) dilué à 1/40 a été placé sur des plaques 96 puits comme
décrit précédemment. Les surnageants de toutes les versions
d'hétérominibody ont été ajoutés purs et en dilutions de 1/2,
35 1/4, 1/8. Un anticorps anti Ckappa humaine biotinylé (Pierce,32
Cat. n° 31780), suivi par de la streptavidine (1/1000) conjuguée
avec de la peroxydase (Dako, Hambourg Cat. n" P0347), a été
utilisé pour la détection des hétérominibodies liés (voir
tableau 4.4). Après lavage quatre fois avec la solution saline
5 tamponnée par phosphate Tween20 à 0,05 %, 1'ELISA a été
finalement développé en ajoutant le substrat ABTS comme décrit
dans 1'exemple 4.4. Pour le contrôle négatif, les plaques ont
été incubées avec la solution saline tamponnée par phosphate au
lieu de structures d'hétérominibody. Le précipité coloré a été
10 mesuré à 405 nm au moyen d'un lecteur ELISA.
La figure 11 : le contrôle FACS des cellules CHO après
transfection avec 17-1A. L'expression du 17-1A transmembranaire
a été accrue par 1'amplification progressive du gène, induite
par addition de concentrations de plus en plus élevées de
15 methotrexate, inhibiteur de dihydrofolate reductase, à une
concentration finale de 500 nM, avec des stades de concentration
compris entre 20 nM et 100 nM. Ces cellules ont été soumises à
un test de 1'expression membranaire de 17-1A par cytométrie en
flux, à une concentration de 10 ug/ml de 1'anticorps M79
20 spécifique à 17-1A (Göttinger, In6.J. Cancer 38 (1986) 47-53),
suivi par un anticorps polyclonal de chèvre anti IgG + IgM (H+L)
de souris, étiqueté par isothiocyanate de fluorescéine, dilué à
1/100 dans une solution saline tamponnée par phosphate. Pour le
contrôle négatif, des cellules CHO non transfectées ont été
25 utilisées, tandis que la lignée cellulaire Kato du cancer de
l'estomac humain, 17-lA-positif, obtenu à partir de ATCC a servi
de contrôle positif.
La figure 12 : l'incorporation de BrdU dans des cellules T
CD4+CD45RA+ après stimulation avec 1'hétérominibody
30 M79CK/CD80CH1 et/ou M79scFv-antiCD3scFv. Après 3 jours de
stimulation, les cellules ont été incubées avec BrdU pendant 14
heures. Le test a été réalisé comme préconisé dans la
description du produit par Boehringer Mannheim Cat. n° 1647229.
Les valeurs de la densité optique ont été mesurées à 4 50 nm au
35 moyen d'un lecteur ELISA.33
Abréviations :
sans CHO max = sans cellules CHO transfectées par 17-1A plus 250
ng/ml d'anticorps bispécifique simple chaîne M79scFv-anti-
CD2scFv plus 500 ng/ml d'hétérominibody M79scFv CK/CD80CH1.
5 sans CHO Bimax = sans cellules CHO transfectées par 17-1A plus
250 ng/ml d'anticorps bispécifique simple chaîne M7 9scFv-anti-
CD2scFv
PBLsMBmaxBimax = cellules CHO transfectées par 17-1A plus
cellules mononucléaires non séparées provenant de sang
10 périphérique, plus 250 ng/ml d'anticorps bispécifique simple
chaîne M79scFv-anti-CD3scFv plus 500 ng/ml d'hétérominibody
M79scFv CK/CD80CH1.
PBLBimax = cellules CHO transfectées par 17-IA plus cellules
mononucléaires non séparées provenant de sang périphérique, plus
15 250 ng/ml d'anticorps bispécifique simple chaîne M79scFv-anti-
CD2scFv.
PBL neg = contrôle négatif consistant en cellules CHO
transfectées par 17-IA plus cellules mononucléaires non séparées
provenant de sang périphérique.
20 La figure 13 : le pourcentage de cellules T CD4+
CD4 5RA+CD4 5R0- après 3 jours de stimulation des cellules T
CD4+CD45RA+ avec 1'hétérominibody M7 9CK/CD80CH1 et/ou M7 9scFv-
anti-CD3 analysé par FACS.
Les niveaux d'expression de CD4 5RA et CD4 5R0 ont été analysés
25 par cytométrie en flux après 3 jours de stimulation des cellules
T CD4+CD45RA+ avec 500 ng/ml d'hétérominibody M7 9CK/CD80CH1
et/ou 250, 50, 10, 2 ng/ml de M79scFv-anti-CD3 scFv. La figure
5.4.1 indique le pourcentage de cellules T CD4+CD45RA-CD45R0+ de
toutes les cellules pontées. 100.000 cellules ont été lavées une
30 fois avec une solution saline tamponnée par phosphate et
incubées pendant 30 minutes avec un anticorps anti CD45RA
humain, conjugué avec R-phycoérythrine (2H4 Coulter), dilué à
1/50 et avec un anticorps anti CD45RO humain, conjugué avec
isothiocyanate de fluorescéine (UHCL-1 DAKO Hambourg), dilué à
35 1/50, et lavées à nouveau une fois avec la solution saline34
tamponnée par phosphate. Pour le contrôle positif, des cellules
mononucléaires de sang périphérique ont été stimulées avec 500
ng/ml d'hétérominibody M79CK/CD80CH1 et/ou 250 ng/ml de M79scFv-
antiCD3scFv. Pour les contrôles négatifs, des cellules
5 mononucléaires de sang périphérique non stimulées et des
cellules T CD4+CD4 5RO- purifiées ont été stimulées avec 500
ng/ml d'hétérominibody M79CK/CD80CH1 et/ou 250 ng/ml de M79scFv-
antiCD3scFv sans cellules CHO transfectées par 17-1A.
Abréviations, voir légende de la fig. 12.
10 La figure 14 : le pourcentage de cellules T CD4+ CD45RA-
CD45R0+ après 6 jours de stimulation des cellules T CD4+CD45RA+
avec 1'hétérominibody M79CK/CD80CH1 et/ou M79scFv-anti-CD3 scFv
analysé par FACS.
Les niveaux d'expression de CD4 5RA et CD45R0 ont été analysés
15 par cytométrie en flux après 6 jours de stimulation des cellules
T CD4+CD45RA+ avec 500 ng/ml d'hétérominibody M79CK/CD80CH1
et/ou 250, 50, 10, 2 ng/ml de M79scFv-anti-CD3 scFv. La figure
5.4.1 indique le pourcentage de cellules T CD4+CD45RA-CD45R0+ de
toutes les cellules pontées. 100.000 cellules ont été lavées une
20 fois avec une solution saline tamponnée par phosphate et
incubées pendant 30 minutes avec un anticorps anti CD4 5RA
humain, conjugué avec R-phycoérythrine (2H4 Coulter), dilué à
1/50 et avec un anticorps anti CD45RO humain, conjugué avec
isothiocyanate de fluorescéine (UHCL-1 DAKO Hambourg), dilué à
25 1/50, et lavées à nouveau une fois avec la solution saline
tamponnée par phosphate. Pour le contrôle positif, des cellules
mononucléaires de sang périphérique ont été stimulées avec 500
ng/ml d'hétérominibody M79CK/CD80CH1 et/ou 250 ng/ml de M79scFv-
antiCD3scFv. Pour les contrôles négatifs, des cellules
30 mononucléaires de sang périphérique non stimulées et des
cellules T CD4+CD45RO- purifiées ont été stimulées avec 500
ng/ml d'hétérominibody M79CK/CD80CH1 et/ou 250 ng/ml de M79scFv-
antiCD3scFv sans cellules CHO transfectées par 17-IA.
Abréviations, voir légende de la fig. 12.35
La figure 15 : l'analyse par test ELISA de y-IFN de cellules T
CD4+ CD45RA+ après 3 jours de stimulation avec 1'hétérominibody
M79CK/CD80CH1 et/ou M79scFv-anti-CD3 scFv. Le surnageant de la
culture cellulaire a été dilué à 1/5 avant l'analyse par test
5 ELISA, le standard y (fourni avec le kit de test) a été utilisé
comme contrôle positif. Comme contrôle négatif, les puits ont
été incubés avec du milieu de culture cellulaire. Le test ELISA
a été effectué selon la recommandation donnée par le manuel du
fabricant (Genzyme DuoSet, Genzyme Diagnostics Cambridge, MA USA
10 Cat. n° 80-3932-00) et développé par la solution de substrat
ABTS, comme décrit dans 1'exemple 2.1. Les valeurs de la densité
optique ont été mesurées à 4 05nm au moyen d'un lecteur ELISA.
Abréviations, voir légende de la fig. 12.
La figure 16 : l'analyse par test ELISA de y-IFN de cellules T
15 CD4+ CD4 5RA+ après 6 jours de stimulation avec 1'hétérominibody
M79CK/CD80CH1 et/ou M79scFv-anti-CD3 scFv. Le surnageant de la
culture cellulaire a été dilué à 1/5 avant l'analyse par test
ELISA, le standard y-IFN (fourni avec le kit de test) a été
utilisé comme contrôle positif. Comme contrôle négatif, les
20 puits ont été incubés avec du milieu de culture cellulaire. Le
test ELISA a été effectué selon la recommandation donnée par le
manuel du fabricant (Genzyme DuoSet, Genzyme Diagnostics
Cambridge, MA USA Cat. n° 80-3932-00) et développé par la
solution de substrat ABTS, comme décrit dans 1'exemple 2.1. Les
25 valeurs de la densité optique ont été mesurées à 4 05nm au moyen
d'un lecteur ELISA. Abréviations, voir légende de la fig. 12.
La figure 17 : l'analyse par test ELISA d'IL-5 de cellules T
CD4+ CD45RA+ après 3 jours de stimulation avec 1'hétérominibody
M79CK/CD80CH1 et/ou M79scFv-anti-CD3 scFv. Le surnageant de la
30 culture cellulaire a été analysé non dilué, le standard IL-5
(fourni avec le kit de test) a été utilisé comme contrôle
positif. Comme contrôle négatif, les puits ont été incubés avec
du milieu de culture cellulaire. Le test ELISA a été effectué
selon la recommandation donnée par le manuel du fabricant
35 (Genzyme DuoSet, Genzyme Diagnostics Cambridge, MA USA Cat. n°36
80-5025-00) et développé par la solution de substrat ABTS, comme
décrit dans 1'exemple 2.1. Les valeurs de la densité optique ont
été mesurées à 405nm au moyen d'un lecteur ELISA. Abréviations,
voir légende de la fig. 12.
5 La figure 18 : l'analyse par test ELISA d'IL-5 de cellules T
CD4+ CD45RA+ après 6 jours de stimulation avec 1'hétérominibody
M79CK/CD80CH1 et/ou M79scFv-anti-CD3 scFv. Le surnageant de la
culture cellulaire a été analysé non dilué, le standard IL-5
(fourni avec le kit de test) a été utilisé comme contrôle
10 positif. Comme contrôle négatif, les puits ont été incubés avec
du milieu de culture cellulaire. Le test ELISA a été effectué
selon la recommandation donnée par le manuel du fabricant
(Genzyme DuoSet, Genzyme Diagnostics Cambridge, MA USA Cat. n°
80-5025-00) et développé par la solution de substrat ABTS, comme
15 décrit dans 1'exemple 2.1. Les valeurs de la densité optique ont
été mesurées à 405nm au moyen d'un lecteur ELISA. Abréviations,
voir légende de la fig. 12.
La figure 19 : l'incorporation de BrdU dans des cellules
CD8+CD45RA+ après 3 jours de stimulation avec 1'hétérominibody
20 M79CK/CD80CH1 et/ou M79scFv-antiCD3scFv. Après 3 jours de
stimulation, les cellules ont été incubées avec BrdU pendant 14
heures. Le test a été réalisé comme préconisé dans la
description du produit par Boehringer Mannheim Cat. n° 1647229.
Les valeurs de la densité optique ont été mesurées à 4 50 nm au
25 moyen d'un lecteur ELISA. Abréviations, voir légende de la fig.
12.
La figure 20 : le pourcentage de cellules T CD8+ CD45RA-
CD45R0+ après 4 jours de stimulation des cellules T CD8+CD45RA+
avec 1'hétérominibody M79CK/CD80CH1 et/ou M79scFv-anti-CD3 scFv
30 analysé par FACS.
Les niveaux d'expression de CD45RA et CD45R0 ont été analysés
par cytométrie en flux après 4 jours de stimulation des cellules
CD8+CD45RA avec 500 ng/ml d'hétérominibody M79CK/CD80CH1 et/ou
250, 50, 10, 2 ng/ml de M79scFv-anti-CD3 scFv. La figure 5.4.1
35 indique le pourcentage de cellules T CD8+CD45RA-CD45RÜ+ de37
toutes les cellules pontées. 100.000 cellules ont été lavées une
fois avec une solution saline tamponnée par phosphate et
incubées pendant 30 minutes avec un anticorps anti CD4 5RA
humain, conjugué avec R-phycoérythrine (2H4 Coulter), dilué à
5 1/50 et avec un anticorps anti CD45RO humain, conjugué avec
isothiocyanate de fluorescéine (UHCL-1 DAKO Hambourg), dilué à
1/50, et lavées à nouveau une fois avec la solution saline
tamponnée par phosphate. Pour le contrôle positif, des cellules
mononucléaires de sang périphérique ont été stimulées avec 500
10 ng/ml d'hétérominibody M79CK/CD80CH1 et/ou 250 ng/ml de M79scFv-
antiCD3scFv. Pour les contrôles négatifs, des cellules
mononucléaires de sang périphérique non stimulées et des
cellules T CD8+CD45RO- purifiées ont été stimulées avec 500
ng/ml d'hétérominibody M79CK/CD80CH1 et/ou 250 ng/ml de M79scFv-
15 antiCD3scFv sans cellules CHO transfectées par 17-1A.
Abréviations, voir légende de la fig. 12.
La figure 21 : le pourcentage de cellules T CD8 + CD45RA-
CD45R0+ après 6 jours de stimulation des cellules T CD8+CD45RA+
avec 1*hétérominibody M79CK/CD80CH1 et/ou M79scFv-anti-CD3 scFv
20 analysé par FACS.
Les niveaux d'expression de CD4 5RA et CD45R0 ont été analysés
par cytométrie en flux après 6 jours de stimulation des cellules
T CD8+CD4 5RA+ avec 500 ng/ml d'hétérominibody M79CK/CD80CH1
et /ou 250, 50, 10, 2 ng/ml de M79scFv-anti-CD3 scFv. La figure
25 5.4.1 indique le pourcentage de cellules T CD8+CD45RA-CD45R0+ de
toutes les cellules pontées. 100.000 cellules ont été lavées une
fois avec une solution saline tamponnée par phosphate et
incubées pendant 30 minutes avec un anticorps anti CD45RA
humain, conjugué avec R-phycoérythrine (2H4 Coulter), dilué à
30 1/50 et avec un anticorps anti CD45RO humain, conjugué avec
isothiocyanate de fluorescéine (UHCL-1 DAKO Hambourg), dilué à
1/50, et lavées à nouveau une fois avec la solution saline
tamponnée par phosphate. Pour le contrôle positif, des cellules
mononucléaires de sang périphérique ont été stimulées avec 500
35 ng/ml d'hétérominibody M79CK/CD80CH1 et/ou 250 ng/ml de M79scFv-38
antiCD3scFv. Pour les contrôles négatifs, des cellules
mononucléaires de sang périphérique non stimulées et des
cellules T CD8+CD45RO- purifiées ont été stimulées avec 500
ng/ml d'hétérominibody M79CK/CD80CH1 et/ou 250 ng/ml de M79scFv-
5 antiCD3scFv sans cellules CHO transfectées par 17-IA.
Abréviations, voir légende de la fig. 12.
La figure 22 : l'analyse par test ELISA de TNF-a de cellules T
CD8+ CD45RA+ après 4 jours de stimulation avec 1'hétérominibody
M79CK/CD80CH1 et/ou M79scFv-anti-CD3 scFv. Le surnageant de la
10 culture cellulaire a été analysé non dilué, le standard TNF-a
(fourni avec le kit de test) a été utilisé comme contrôle
positif. Comme contrôle négatif, les puits ont été incubés avec
du milieu de culture cellulaire. Le test ELISA a été effectué
selon la recommandation donnée par le manuel du fabricant
15 (Genzyme DuoSet, Genzyme Diagnostics Cambridge, MA USA Cat. n"
80-3933-00) et développé par la solution de substrat ABTS, comme
décrit dans 1 ' exemple 2.1. Les valeurs de la densité optique ont
été mesurées à 405nm au moyen d'un lecteur ELISA. Abréviations,
voir légende de la fig. 12.
20 La figure 23 : la conception moléculaire de 1'hétérominibody
M79scFv-CK-antiCD3scFv/CD80CHl représenté au niveau protéique.
Chi et CK indiquent le premier domaine constant de la chaîne
lourde d'IgGl humaine et la région constante de la chaîne légère
d'Ig-kappa humaine respectivement, qui forment ensemble 1'unité
25 d'hétérodimérisation, réunies de manière covalente par un pont
disulfure (S-S). VH indique la région variable de la chaîne
lourde d'Ig et VL la région variable de la chaîne légère d'Ig.
La figure 24 ; la conception de diverses constructions CD80-
scFv bifonctionnelles présentant les éléments de construction au
30 niveau protéique. VH indique la région variable de la chaîne
lourde d'Ig, VL celle de la chaîne légère d'Ig.
La figure 25 : la conception de diverses constructions CD80-
scFv bifonctionnelles présentant les éléments de construction au
niveau de l'ADN ainsi que les sites de clivage par enzymes de
35 restriction utilisés.39
La figure 26 : l'analyse par test ELISA de surnageant de
culture cellulaire obtenu à partir de cellules CHO transfectées
avec le plasmide d'expression pEF-DHFR+CTI+CD80-M79scFv(VL/VH)
incluant la séquence codante pour le fragment de liaison court
5 (Gly4Seri) 1. Des plaques ELISA 96 puits ont été incubées avec 50
u.1 d'antigène 17-1A soluble (50 ul/ml) par puits. Ensuite des
dilutions de surnageant pur de culture cellulaire ont été
ajoutées comme indiqué. La détection a été effectuée par un
anticorps IgGl de souris anti étiquette histidine (Dianova,
10 Hambourg) dilué à 1/1000 et un anticorps polyclonal de chèvre
anti IgG de souris (Fc) conjugué à de la peroxydase (Dianova
Hambourg) dilué à 1/5000. L'anticorps bispécifique simple chaîne
anti-17-lA/anti-CD3 (Mack, Proc. Natl. Sei. USA 92 (1995) 7021-
7025) a été utilisé comme contrôle positif. Pour le contrôle
15 négatif, les puits ont été incubés avec une solution saline
tamponnée par phosphate. Le test ELISA a été développé par
solution de substrat ABTS, comme décrit dans 1'exemple 2.1. Les
valeurs de la densité optique ont été mesurées à 4 05nm au moyen
d'un lecteur ELISA.
20 La figure 27 : l'analyse par test ELISA de surnageant de
culture cellulaire obtenu à partir de cellules CHO transfectées
avec le plasmide d'expression pEF-DHFR+CTI+CD80-M79scFv(VL/VH)
incluant la séquence codante pour le fragment de liaison court
(GlyaSeri)!. Des plaques ELISA 96 puits ont été incubées avec 50
25 ul d'antigène 17-1A soluble (50 ul/ml) par puits. Ensuite le
surnageant pur de culture cellulaire et des dilutions de celui-
ci ont été ajoutés comme indiqué. La détection a été effectuée
par un anticorps anti IgGl de souris anti CD80 dilué à 1/1000,
suivi par un anticorps polyclonal de chèvre anti IgG de souris
30 (spécifique Fc) conjugué à de la peroxydase (Dianova Hambourg)
dilué à 1/5000. L'anticorps bispécifique simple chaîne anti-17-
lA/anti-CD3 (Mack, Proc. Natl. Acad. Sei. USA 92 (1995) 7021-
7025) a été utilisé comme contrôle positif et détecté comme
indiqué dans Fig 26. Pour le contrôle négatif, les puits ont été
35 incubés avec une solution saline tamponnée par phosphate. Le40
test ELISA a été développé par solution de substrat ABTS, comme
décrit dans 1'exemple 2.1. Les valeurs de la densité optique ont
été mesurées à 405nm au moyen d'un lecteur ELISA.
La figure 28 : l'analyse par test ELISA de la construction
5 CD80-M7 9scFv(VL/VH) recombinante purifiée avec un fragment de
liaison court (Gly4Seri)i obtenu par purification à partir de
surnageant de culture cellulaire au moyen d'une colonne Ni-NTA
telle qu'elle a été décrite (Mack, Proc. Natl. Acad. Sei. USA 92
(1995) 7021-7025). Des plaques ELISA 96 puits ont été
10 recouvertes durant la nuit à 4°C par un éluat pur provenant de
la colonne Ni-NTA et par des dilutions de celui-ci, comme
indiqué. Ensuite, la protéine recombinante liée a été détectée
par un anticorps IgGl de souris anti CD80 dilué à 1/1000 ou par
un anticorps IgGl de souris anti étiquette histidine (Dianova,
15 Hambourg) dilué à 1/1000, suivi par un anticorps polyclonal de
chèvre anti IgG de souris (Fc) conjugué à de la peroxydase
(Dianova Hambourg) respectivement dilué à 1/5000. Pour le
contrôle négatif, des puits ont été recouverts durant la nuit à
4°C de sérum-albumine bovine à 3 % dans une solution saline
20 tamponnée par phosphate. Le test ELISA a été développé par
solution de substrat ABTS, comme décrit dans 1'exemple 2.1. Les
valeurs de la densité optique ont été mesurées à 4 05nm au moyen
d'un lecteur ELISA.
La figure 29 : l'analyse par test ELISA de surnageant de
25 culture cellulaire obtenu à partir de cellules CHO transfectées
avec le plasmide d'expression pEF-DHFR+CTI+CD80-M79scFv(VH/VL)
incluant la séquence codante pour le fragment de liaison court
(Gly4Seri)i- Des plaques ELISA 96 puits ont été incubées avec
l'antigène 17-IA soluble (50 .ul/ml) par puits. Ensuite le
30 surnageant pur de culture cellulaire et des dilutions de celui-
ci ont été ajoutés comme indiqué. La détection a été effectuée
par un anticorps IgGl de souris anti CD80 dilué à 1/1000, suivi
par un anticorps polyclonal de chèvre anti IgG de souris (Fc)
conjugué à de la peroxydase (Dianova Hambourg) dilué à 1/5000.
35 L'anticorps bispécifique simple chaîne anti-17-lA/anti-CD341
(Mack, Proc. Natl. Acad. Sei. USA 92 (1995) 7021-7025) a été
utilisé comme contrôle positif et détecté comme indiqué par la
fig. 26. Pour le contrôle négatif, les puits ont été incubés
avec une solution saline tamponnée par phosphate. Le test ELISA
5 a été développé par solution de substrat ABTS, comme décrit dans
1'exemple 2.1. Les valeurs de la densité optique ont été
mesurées à 405nm au moyen d'un lecteur ELISA.
La figure 30 : une séquence d'ADN de 1'oligonucleotide double
brin désigné par ACCGS15BAM avec des exprémités sortantes simple
10 brin compatibles avec celles des enzymes de restriction BspEI et
BamHI. Des acides aminés codés par la séquence de nucleotide
sont indiqués.
La figure 31 : 1'analyse par test ELISA de surnageant de
culture cellulaire et de ses dilutions obtenus à partir de
15 cellules CHO transfectées avec le plasmide d'expression pEF-
DHFR+CTI+CD80-M79scFv(VH/VL) incluant la séquence codante pour
le fragment de liaison long (Gly^SerO 3. Des plaques ELISA 96
puits ont été incubées avec 50 (il d'antigène 17-1A soluble (50
ul/ml) par puits. Ensuite le surnageant pur de culture
20 cellulaire et des dilutions de celui-ci ont été ajoutés comme
indiqué. La protéine liée a été détectée par un anticorps murin
anti étiquette histidine (Dianova, Hambourg) dilué à 1/1000,
suivi par un anticorps polyclonal de chèvre anti IgG de souris
(Fc) conjugué à de la peroxydase (Dianova Hambourg) dilué à
25 1/5000. L'anticorps bispécifique simple chaîne anti-17-lA/anti-
CD3 (Mack, Proc. Natl. Acad. Sei. USA 92 (1995) 7021-7025) a été
utilisé comme contrôle positif. Pour le contrôle négatif, les
puits ont été incubés avec une solution saline tamponnée par
phosphate. Le test ELISA a été développé par solution de
30 substrat ABTS, comme décrit dans 1'exemple 2.1. Les valeurs de
la densité optique ont été mesurées à 405nm au moyen d'un
lecteur ELISA.
La figure 32 : la conception moléculaire de fragments d'ADN
codant pour les chaînes polypeptidiques simples de
35 1'hétérominibody M79scFv-CK-antiCD3scFv/CD80CHl. Les symboles42
sont les mêmes que sur les figures 1(A) et 1(B), le vecteur
d'expression pEF-DHFR ou pEF-ADA utilisé pour le clonage et
1'expression de chaînes individuelles est indiqué, Gly^Ser!
indique un fragment de liaison d'acide S-aminé glycine-sérine.
5 La figure 33 : le passage de phénotype des cellules T CD45
RA+/R0-CD4 à des cellules T RA-/RO+ CD4 induit par amorçage in
vitro. L'expression de CD45RA et CD45RO sur cellules
mononucléaires de sang périphérique et des cellules T
CD4+CD45RO- naïves purifiées a été analysée par FACS le jour 0.
10 Les niveaux d'expression de CD45RA et CD45RO des cellules
CD4+CD4 5RO- ont été également analysés par cytométrie en flux
après 6 jours de stimulation avec 500 ng/ml d'hétérominibody
M7 9scFvCK/CD80CHl et/ou 250 ng/ml d'anticorps bispécifique
simple chaîne M7 9scFv-antiCD3scFv en contact avec des cellules
15 CHO transfectées par 17-1A irradiées. 100.000 cellules T ont été
lavées une fois avec une solution saline tamponnée par phosphate
et incubées pendant 30 minutes avec un anticorps anti CD4 5RA
humain, conjugué avec une phycoérythrine (2H4 Coulter), dilué à
1/50 et avec un anticorps anti CD4 5RO humain, conjugué avec
20 isothiocyanate de fluorescéine (UHCL-1 DAKO Hambourg), dilué à
1/50, et lavées à nouveau une fois avec la solution saline
tamponnée par phosphate avant cytométrie en flux.
La figure 34 : le passage de phénotype des cellules T CD4 5
RA+/RO-CD8 à des cellules T RA-/RO+ CD8 T. L'expression de
25 CD45RA et CD45RO sur des cellules mononucléaires de sang
périphérique et des cellules T CD8+CD4 5RO- naïves purifiées a
été analysée par FACS le jour 0. Les niveaux d'expression de
CD4 5RA et CD45RO des cellules CD4+CD4 5RO- ont été également
analysés par cytométrie en flux après 6 jours de stimulation
30 avec 500 ng/ml d'hétérominibody M79scFvCK/CD80CHl et/ou 250
ng/ml d'anticorps bispécifique simple chaîne M7 9scFv-antiCD3scFv
en contact avec des cellules CHO transfectées par 17-1A
irradiées. 100.000 cellules T ont été lavées chacune une fois
avec une solution saline tamponnée par phosphate et incubées
35 pendant 30 minutes avec un anticorps anti CD45RA humain,43
conjugué avec une phycoérythrine (2H4 Coulter), dilué à 1/50 et
avec un anticorps anti CD4 5RO humain, conjugué avec
isothiocyanate de fluorescéine (UHCL-1 DAKO Hambourg), dilué à
1/50, et lavées à nouveau une fois avec la solution saline
5 tamponnée par phosphate avant cytométrie en flux.
La figure 35 : un essai de libération de 51Cr avec des cellules
naïves T CD8+ CD4 5RA+ CD45RO- (avant amorçage) et cellules T
dérivées de celle-ci, par amorçage in vitro avec
1'hétérominibody M79scFvCK/CD80CHl et 1'anticorps bispécifique
10 simple chaîne M79scFv-antiCD3scFv (après amorçage). Les cellules
T ont été redirigées contre les cellules Kato positives pour 17-
1A par différentes concentrations d'anticorps bispécifique
simple chaîne M7 9scFv-antiCD3scFv, comme indiqué ;
éventuellement, 1'hétérominibody M79scFvCK/CD80CHl a été présent
15 pendant l'essai de libération de 51Cr à une concentration de 500
ng/ml. Des cellules mononucléaires de sang périphérique ont été
utilisées comme contrôle positif. Le temps d'incubation a été de
20 heures à un rapport E/T de 20/1.
La figure 36 : SDS-PAGE (7,5 %) de 1'hétérominibody
20 M7 9scFvCK/CD80CHl. La coloration Coomassie de 1'hétérominibody
M79scFvCK/CD80CHl purifié est représentée dans des conditions
réductrices (panneau de gauche) et non réductrices (panneau de
droite) . Dans les deux panneaux, un standard de poids
moléculaire est indiqué.
25 La figure 37 : la liaison de 1'hétérominibody
M79scFvCK/CD80CHl à des cellules CHO non-transfectées ou
transfectées par 17-1A. 200.000 cellules de chacune des lignées
cellulaires ont été incubées pendant 30 minutes avec
1'hétérominibody M7 9scFvCK/CD80CHl à une concentration de 0,2
30 uq/ml. Ensuite, les cellules ont été lavées deux fois dans une
solution saline tamponnée par phosphate et incubées pendant 30
minutes avec un anticorps spécifique anti Ckappa humaine conjugué
avec isothiocyanate de fluorescéine (Coulter 6604287), dilué à
1/10. Après deux étapes finales de lavage dans la solution
35 saline tamponnée par phosphate, les cellules ont été analysées44
par cytométrie en flux (FACS-SCAN Becton Dickinson
Immunocytometry Systems, San Jose CA, Etats-Unis).
La figure 38 : la liaison de 1'hétérominibody
M79scFvCK/CD80CHl à CD28 sur cellules T. 100.000 cellules T
5 CD8+CDllb- naïves purifiées ont été incubées pendant 30 minutes
avec 200 ug/ml d'hétérominibody M79scFvCK/CD80CHl. Ensuite, les
cellules ont été lavées deux fois dans la solution saline
tamponnée par phosphate et incubées pendant 30 minutes avec un
anticorps spécifique anti CkapPa humaine conjugué avec
10 isothiocyanate de fluorescéine (Coulter 6604287), dilué à 1/10.
Après deux étapes finales de lavage dans la solution saline
tamponnée par phosphate, les cellules ont été analysées par
cytométrie en flux.
La figure 39 : la liaison de 1'hétérominibody
15 M79scFvCK/CD80CHl à CTLA-4, telle que mesurée par ELISA. Des
plaques ELISA 96 puits ont été recouvertes de 50 ul par puits de
chimère CTLA-4/Fc soluble (R&D Systems, Minneapolis MN, Etats-
Unis, Cat. n° 325-CT) à une concentration de 10 ug/ml. Ensuite,
différentes concentrations d'hétérominibody M7 9scFvCK/CD80CHl
20 purifié, dans une solution saline tamponnée par phosphate, ont
été ajoutées. La détection a été effectuée par un anticorps
spécifique anti Ckappa humaine biotyliné (Pierce, Cat. n° 31780)
dilué à 1/1000, suivi par de l'avidine conjuguée avec de la
peroxydase (Dako, Hambourg, Cat. n' p0347), diluée à 1/1000.
25 Comme contrôle négatif, certains puits ont été incubés avec une
protéine de fusion CD4-Ig. Le test ELISA a été développé par
solution de substrat ABTS, comme décrit dans 1'exemple 2.1. Les
valeurs de la densité optique ont été mesurées à 405nm au moyen
d'un lecteur ELISA.
30 La figure 40 : la liaison de 1'hétérominibody M79scFvCK-
antiCD3scFv/CDB0CHl à l'antigène 17-1A recombinant immobilisé.
Des plaques ELISA 96 puits ont été incubées avec 50 ul
d'antigène 17-1A soluble (50 ug/ml). Ensuite, du surnageant pur
de culture cellulaire de cellules CHO transfectées avec
35 1'hétérominibody M79scFvCK-antiCD3scFv/CD80CHl a été ajouté, de45
manière correspondant à la sélection primaire (PS) ou au premier
stade d'amplification du gène (l.Amp). La détection de
1'hétérominibody lié a été effectuée par un anticorps
monocolonal spécifique de CD80 (Immunotech, Cat. n° 1449), dilué
5 à 1/1000, et un anticorps polyclonal de chèvre anti IgG de
souris (Fc) conjugué à de la peroxydase (Dianova, Hambourg),
dilué à 1/5000. Comme contrôle négatif, des puits ont été
incubés avec une solution saline tamponnée par phosphate. Le
test ELISA a été développé par solution de substrat ABTS, comme
10 décrit dans 1'exemple 2.1. Les valeurs de la densité optique ont
été mesurées à 405nm au moyen d'un lecteur ELISA.
La figure 41 : 1'analyse par test ELISA de surnageants de
culture cellulaire de cellules CHO transfectées avec les
plasmides d'expression pEF-DHFR-M79scFvCK-antiCD3scFv et pEF-ADA
15 CH80CH1, de manière correspondant à la sélection primaire (PS)
et à différents stades d'amplification du gène (1.-3. Amp) ,
comme indiqué. Des plaques ELISA 96 puits ont été incubées avec
50 ul par puits d'antigène 17-1A soluble (50 ug/ml). Ensuite,
des surnageants purs contenant 1'hétérominibody M79scFvCK-
20 antiCD3scFv/CD80CHl ont été ajoutés. La détection a été
effectuée par un anticorps anti étiquette histidine, marqué par
de la peroxydase (Roche, 1965085), dilué à 1/500. Comme contrôle
négatif, des puits ont été incubés avec une solution saline
tamponnée par phosphate. Le test ELISA a été développé par
25 solution de substrat ABTS, comme décrit dans 1'exemple 2.1. Les
valeurs de la densité optique ont été mesurées à 4 05nm au moyen
d'un lecteur ELISA.
La figure 42 : la liaison de 1'hétérominibody M79scFvCK-
antiCD3scFv/CD80CHl à CD3 sur des cellules T humaines.
30 100.000 cellules T CD8+ CD3+CDllb+- ont été incubées pendant 30
minutes avec 400 ug/ml (trait noir épais) et 50 ug/ml (trais
gris fin) d'hétérominibody M79scFvCK-antiCD3scFv/CD80CHl.
Ensuite, les cellules ont été lavées deux fois dans une solution
saline tamponnée par phosphate et incubées pendant 30 minutes
35 avec un anticorps spécifique anti CkapPa humaine conjugué avec46
isothiocyanate de fluorescéine (Coulter 6604287) dilué à 1/10.
Comme contrôle négatif, des puits ont été incubés avec une
solution saline tamponnée par phosphate (trait en tirets) au
lieu de 1'hétérominibody. Après deux étapes de lavage finales
5 dans une solution saline tamponnée par phosphate, les cellules
ont été analysées par cytométrie en flux.
La figure 43 : la conception moléculaire de 1'hétérominibody
bscAbM7 9scFv- antiCD3scFv-CK/CD80-CHl, représentée au niveau
protéique. CHI et CK indiquent le premier domaine constant de la
10 chaîne lourde de 1'IgGl humaine et la région constante de la
chaîne légère d'Ig-kappa humaine, respectivement, qui forment
ensemble 1'unité d'hétérodimérisation réunies de manière
covalente par un pont de disulfure (S-S) . VH indique la région
variable de la chaîne lourde d'Ig et VL la région variable de la
15 chaine légère.
La figure 4 4 : la conception des deux bras de 1'hétérominibody
bscAbM79scFv- antiCD3scFv-CK/CD80-CHl, représentée au niveau ADN
; les sites de clivage par enzymes de restriction sont indiqués.
VH indique la région variable de la chaîne lourde d'Ig et VL
20 celle de la chaîne légère d'Ig.
La figure 45 : la liaison de 1'hétérominibody bscAbM79scFv-
antiCD3scFv-CK/CD80-CHl à l'antigène 17-1A recombinant
immobilisé, tel que mesuré par ELISA. Des plaques ELISA 96 puits
ont été incubées avec 50 (il par puits d'antigène 17-1A soluble
25 (50 ug/ml). Ensuite, des surnageants purs de culture cellulaire
de cellules CHO transfectées avec 1'hétérominibody bscAbM79scFv-
antiCD3scFv-CK/CD80-CHl ont été ajoutés, de manière
correspondant à la sélection primaire (PS) ou au premier stade
d'amplification du gène (1.Amp). La détection de
30 l'hétérominibody lié a été effectuée par un anticorps anti
étiquette histidine, marqué par la peroxydase (Roche, 1965085),
dilué à 1/500. Comme contrôle négatif, des puits ont été incubés
avec une solution saline tamponnée par phosphate au lieu de
1'hétérominibody. Le test ELISA a été développé par solution de
35 substrat ABTS, comme décrit dans 1'exemple 2.1. Les valeurs de47
la densité optique ont été mesurées à 405nm au moyen d'un
lecteur ELISA.
La figure 46 : l'analyse par test ELISA de l'hétérominibody
bscAbM79scFv- antiCD3scFv-CK/CD80-CHl effectuée avec un
5 anticorps anti CD80 immobilisé. Des plaques ELISA 96 puits ont
été incubées avec 50 /ul par puits d'un anticorps monoclonal anti
CD80 humain (Immunotech Cat. n° 1449) dilué à 1/200. Ensuite,
des surnageants purs de culture cellulaire de cellules CHO
transfectées avec 1'hétérominibody bscAbM7 9scFv- antiCD3scFv-
10 CK/CD80-CH1 ont été ajoutés, de manière correspondant à la
sélection primaire (PS) ou au premier stade d'amplification du
gène (l.Amp). La détection a été effectuée par un anticorps anti
étiquette histidine, marqué par la peroxydase (Roche, 1965Q85),
dilué à 1/500. Comme contrôle négatif, des puits ont été incubés
15 avec une solution saline tamponnée par phosphate au lieu de
1'hétérominibody. Le test ELISA a été développé par solution de
substrat ABTS, comme décrit dans 1'exemple 2.1. Les valeurs de
la densité optique ont été mesurées à 405nm au moyen d'un
lecteur ELISA.
20 La figure 47 : Séquences ADN et d'acides aminés de la
construction M79scFv-IL2 contenant un domaine de dimérisation.
Les nucleotides 10 à 66 codent un peptide leader à 1'extrémité
N-terminale. Les nucleotides 67 à 387 codent la région variable
VL de la chaîne légère d' Ig de M79scFv, les nucleotides 388 à
25 432 codent un fragment de liaison glycine-sérine, suivi par le
domaine variable VH de la chaîne lourde d'Ig de M79scFv
(nucleotides 433 à 777). A 1'extrémité 5' de la région charnière
supérieure d'IgG3 de souris, décrite par Pack (1993)
Biotechnology 11:1271 (nucleotides 784 à 813), 6 nucleotides ont
30 été ajoutés par l'insertion d'un site de clivage EcoRI. Les
nucleotides 814 à 918 codent le domaine de dimérisation dHLX
décrit par Pack (1993) Biotechnology 11:1271, suivi par un court
fragment de liaison peptidique provenant des nucleotides 919 à
936. Le domaine IL-2 (nucleotides 937 à 1341) est suivi par une
35 étiquette histidine sur 1'extrémité C-terminale (nucleotides48
1342 à 1359) et deux codons stop. Les sites de clivage par
enzymes de restriction utilisés pour le clonage sont indiqués.
La figure 48 : Séquences d'ADN et d'acides aminés de la
construction M79scFv-IL2 contenant un domaine de
5 tétramérisation. Les nucleotides 10 à 66 codent un peptide
leader à l'extrémité N-terminale. Les nucleotides 67 à 387
codent la région variable VL de la chaîne légère d'Ig de
M79scFv, les nucleotides 388 à 432 codent un fragment de liaison
glycine-sérine, suivi par le domaine variable VH de la chaîne
10 lourde d'Ig de M79scFv (nucleotides 433 à 777). A l'extrémité 5"
de la région charnière supérieure d'IgG3 humaine, décrite par
Rheinnecker et coll. J. Immunol. 157, (1996) 2989-2997
(nucleotides 784 à 816), 6 nucleotides ont été ajoutés par
1'insertion d'un site de clivage EcoRI. Les nucleotides 817 à
15 933 codent le domaine de tétramérisation de p53 humain
(Rheinnecker et coll. J. Immunol. 157, (1996) 2989-2997), suivi
par un court fragment de liaison peptidique provenant des
nucleotides 934 à 954. Le domaine IL-2 (nucleotides 955 à 1359)
est suivi par une étiquette histidine sur 1'extrémité C-
20 terminale (nucleotides 1360 à 1377) et deux codons stop. Les
sites de clivage par enzymes de restriction utilisés pour le
clonage sont indiqués.
La figure 49 : Séquences d'ADN et d'acides aminés de la
construction DC8scFv/erbB2-EC contenant un domaine de
25 tétramérisation. Les nucleotides 10 à 66 codent un peptide
leader à 1'extrémité N-terminale. Les nucleotides 67 à 390
codent la région variable VL de la chaîne légère d'Ig de
DC8scFv, les nucleotides 391 à 435 codent un fragment de liaison
glycine-sérine, suivi par le domaine variable VH de la chaîne
30 lourde d'Ig de DC8scFv (nucleotides 436 à 771). A l'extrémité 5'
de la région charnière supérieure d'IgG3 humaine, décrite par
Rheinnecker et coll. J. Immunol. 157, (1996) 2989-2997
(nucleotides 775 à 807), 3 nucleotides ont été ajoutés, en
complétant ainsi le triplet suivant de nucleotides pour former
35 un site de clivage BspEI. Les nucleotides 808 à 924 codent le49
domaine de tétramérisation de p53 humain (Rheinnecker et coli.
J. Immunol. 157, (1996) 2989-2997), suivi par un court fragment
de liaison peptidique provenant des nucleotides 925 à 945. Le
domaine erbB2-EC (nucleotides 946 à 2844) est suivi par une
5 étiquette histidine sur 1'extrémité C-terminale (nucleotides
2845-2862) et un codon d'arrêt. Les sites de clivage par enzymes
de restriction utilisés pour le clonage sont indiqués.
La figure 50 : l'analyse par test ELISA de surnageant de
culture cellulaire et de lysat, obtenus à partir de cellules CHO
10 transfectées avec la construction dimère ou tétramère M79scFv-
IL2. Des plaques ELISA 96 puits ont été recouvertes de 50 (il
d'antigène 17-1A soluble (50 ul/ml) par puits. Ensuite du
surnageant pur de culture cellulaire ou du lysat cellulaire
correspondant ont été ajoutés comme indiqué. La détection a été
15 effectuée avec un anticorps anti étiquette histidine, conjugué
avec de la peroxydase (Roche, Cat. n' 1965085) dilué à 1/500.
Comme contrôle négatif, des puits ont été incubés avec une
solution saline tamponnée par phosphate au lieu de la
construction M7 9scFv-IL-2. Le test ELISA a été développé par
20 solution de substrat ABTS, comme décrit dans 1'exemple 2.1. Les
valeurs de la densité optique ont été mesurées à 405nm au moyen
d'un lecteur ELISA.
La figure 51 : A : l'analyse par test ELISA de surnageant de
culture cellulaire et de lysat, obtenus à partir de cellules CHO
25 transfectées avec la construction tétramère M7 9scFv-IL2. Des
plaques ELISA 96 puits ont été recouvertes de 50 ul d'antigène
17-1A soluble (50 ul/ml) par puits. Ensuite, des surnageants
purs de culture cellulaire et le lysat cellulaire correspondant
ainsi que des dilutions de ceux-ci ont été ajoutés comme
30 indiqué. La détection a été effectuée avec un anticorps anti
étiquette histidine, conjugué avec de la peroxydase (Roche, Cat.
n° 1965085) dilué à 1/500. Comme contrôle négatif, des puits ont
été incubés avec une solution saline tamponnée par phosphate au
lieu de la construction tétramère M79scFv-IL-2. Le test ELISA a
35 été développé par solution de substrat ABTS, comme décrit dans50
1'exemple 2.1. Les valeurs de la densité optique ont été
mesurées à 405nm au moyen d'un lecteur ELISA.
La figure 52 : le potentiel de la forme de 1 ' hétérominibody
pour 1'addition de domaines effecteurs à ses extrémités N- et C-
5 terminales.
La figure 53 : un hétérominibody reconnaissant EpCAM avec son
scFvs(HD70) sur son extrémité N-terminale et les cellules
portant des récepteurs IL-2 et GM-CSF avec ses cytokines IL-2 et
GM-CSF liées par son extrémité C-terminale.
10 La figure 54 : des insertions de cADN de deux vecteurs
utilisés pour exprimer 1'hétérominibody représenté
schématiquement sur la figure 53 dans des cellules de
mammifères. Les flèches indiquent les diverses portions
fonctionnelles des inserts et le point dans l'orientation 5'-3'.
15 La figure 55 : A : la séquence nucléotidique complète et la
séquence d'acides aminés déduite, codant pour la chaîne
HD7QscFv-CHl-GM-CSF qui est utilisée pour exprimer la moitié
gauche de 1'hétérominibody représenté schématiquement sur la
figure 53 (partie supérieure de 1'hétérominibody représenté
20 schématiquement sur la figure 54).
B : la séquence nucléotidique complète et la séquence d'acides
aminés déduite, codant pour la chaîne HD70scFv-Ck-IL-2 qui est
utilisée pour exprimer la moitié droite de 1'hétérominibody
représenté schématiquement sur la figure 53 (partie inférieure
25 de 1'hétérominibody représenté schématiquement sur la figure
54).
La figure 56 : la liaison de 1'hétérominibody à des cellules
CHO exprimant de 1'EpCAM humaine. Les vecteurs d'expression
codant pour 1'hétérominibody représenté sur la figure 53 ont été
30 transfectés de manière stable dans des cellules CHO. Les
surnageants provenant de ces cellules ont été testés pour la
production et la sécrétion de l'hétérominibody, par analyse FACS
(FACSCalibur, Beckton Dickinson) au moyen de cellules CHO
exprimant de 1'EpCAM humaine sur leur surface. L'hétérominobody
35 lié a été détecté par un second anticorps se liant à la portion51
GM-CSF de cet hétérominibody particulier et un troisième
anticorps marqué par isothiocyanate de fluorescéine, spécifique
à 1'espèce (voir texte). Panneau supérieur : cellules CHO
exprimant de 1'EpCAM plus milieu de culture cellulaire, panneaux
5 suivants : des surnageants provenant de cellules CHO exprimant
1'hétérominibody ont été dilués dans le milieu de culture
cellulaire (en allant du haut en bas : 1/625, 1/125, 1/25, 1/5
et 1/1) et testés pour l'augmentation de la liaison aux cellules
positives pour EpCAM.
10 La figure 57 : 1 ' activité de liaison de 1 ' EpCAM est
physiquement liée aux immunoréactivités avec GM-CSF et IL-2 dans
les surnageants provenant des cellules CHO produisant
1'hétérominibody. L'hétérominibody représenté sur la figure 53 a
été exprimé dans des cellules CHO et les surnageants de culture
15 cellulaire obtenus ont été incubés avec le domaine
extracellulaire de 1'EpCAM recombinante, immobilisé sur une
plaque ELISA. Après des lavages abondants, 1'hétérominibody lié
a été analysé pour 1'immunoréactivité avec des anticorps
reconnaissant le GM-CSF humain ou l'IL-2 humaine dans un ELISA.
20 La figure 58 : les immunoréactivités de GM-CSF et IL-2 sont
physiquement liées dans les surnageants provenant des cellules
CHO produisant 1'hétérominibody. L'hétérominibody représenté sur
la figure 53 a été exprimé dans des cellules CHO et les
surnageants de culture cellulaire obtenus ont été incubés dans
25 une plaque ELISA recouverte des anticorps anti IL-2 humaine ou
anti GM-CSF humain. L'hétérominibody lié a été testé pour la
réactivité avec un anticorps reconnaissant l'autre cytokine
respective (voir exemples).
La figure 59 : 1'hétérominibody purifié consiste en chaînes
30 liées de manière covalente et immunoréagit avec des anticorps
reconnaissant les protéines de CD humain, IL-2 humaine et GM-CSF
humain dans les Western blots. L'hétérominibody représenté sur
la figure 53 a été exprimé dans des cellules CHO et purifié en
deux étapes à partir du surnageant de culture cellulaire. Une
35 aliquote d'hétérominibody partiellement purifié a été analysée52
par SDS-PAGE à gradient et le gel coloré pour les protéines par
bleu Coomassie (bande 1) . Des aliquotes du surnageant ont été
séparées par SDS-PAGE, avec ensuite electroblotting sur
membranes et immunocoloration avec des anticorps reconnaissant
5 CDD humain (bande 2), IL-2 humaine (bande 3) et GM-CSF humain
(voir exemples) (bande 4). De la streptavidine conjuguée avec de
la phosphatase alcaline a été utilisée pour visualiser les
anticorps primaires liés. La position des standards de poids
moléculaire est indiquée dans les bandes désignées par "S" et
10 leurs tailles sont indiquées en chiffres sur les panneaux de
droite et de gauche. Les flèches indiquent la position de la
bande d'hétérominibody de 116-kDa. Les traits en pointillés
indiquent les positions des marqueurs 188 et 97 kDa.
La figure 60 : la bioactivité de GM-CSF humain lié à
15 1'hétérominibody. L'hétérominibody représenté sur la figure 53 a
été produit dans des cellules CHO, purifié à partir de
surnageants de culture cellulaire, puis testé par un essai de
prolifération au moyen de la lignée TF-1 de cellules de
l'érythroleucémie humaine, sensibles à GM-CSF. L'aliquote
20 d'hétérominibody testée contenait > 300 Ul/ml de GM-CSF, mesuré
par titrage par rapport à un standard de GM-CSF humain.
La figure 61 : la bioactivité d'IL-2 humaine liée à
1'hétérominibody. L'hétérominibody représenté sur la figure 53 a
été produit dans des cellules CHO, purifié à partir de
25 surnageants de culture cellulaire, puis testé par un essai de
prolifération utilisant la lignée CL96 de cellules T de souris
sensibles à l'IL-2 humaine. L'aliquote d'hétérominibody testée
contenait > 10.000 Ul/ml d'IL-2 humaine, mesuré par titrage par
rapport à un standard d'IL-2 humaine.
30 L'invention sera décrite ci-après en se référant aux exemples
biologiques suivants qui sont donnés simplement pour
illustration et ne doivent pas être interprétés comme une
limitation de l'étendue de la présente invention.
Exemple 1
35 Exemple 1.1 : hétérominibody M79scFvCHl/CD80CK53
On a réalisé une protéine qui relie le fragment Fv (scFV) simple
chaîne de l'anticorps murin M79 anti 17-lA (Göttlinger, Int. J.
Cancer 38 (1986) 47-53) avec les domaines extracellulaires de
CD80 humain en vertu de 1 ' association hétérodimérique des
5 domaines d'immunoglobuline CHI provenant de la chaîne lourde yl
humaine et Ck, la région constante de la chaîne légère de kappa
humaine. Dans ce but, le M79scFv a été relié au CHI humain, et
la partie extracellulaire du CD80 humain a été réunie à la
Ckappa humaine, les chaînes obtenues, codant pour les
10 polypeptides, ont été introduites dans des vecteurs d'expression
séparés et ont été transfectées dans la même lignée de cellules
hôtes de mammifère résultant dans 1'hétérominibody CD80
représenté sur la figure 1. Dans 1'exemple suivant, la procédure
de construction est décrite pas à pas.
15 Exemple 1.1.1 : Réalisation de la chaîne CD80-CK
Tout d'abord, la chaîne CD80-Ckappa a été assemblée. Le fragment
d'ADN de Ck a été obtenu par PCR en utilisant des amorces
spécifiques 5 ' et 3 ' . La matrice de cADN pour cette PCR a été
préparé par transcription inverse de 1'ARN total préparé à
20 partir de cellules mononucléaires de sang périphérique humain
selon des procédures standard (Sambrook, Molecular Cloning ; A
Laboratory Manual, 2nd Edition, Cold Spring Harbour Laboratory
Press, Cold Spring Harbour, New York (1989)). L'amorce
5'HuCKBspEl introduit les sites de clivage de restriction BspEl
25 et BsiWl ainsi que la région charnière d'IgG3 (5'HuCKBspEl:
5'AAT TCC GGA ACC CCG CTG GGT GAC ACC ACC CAC ACC CGT ACG GTG
GCT GCA CCA TCT GTC TTC 3'), l'amorce 3'HuCKSalNOT introduit les
sites de clivage Sali et Notl (3'HuCKSalNOT : 5'ATA AGA ATG CGG
CCG CGT CGA CTA ACA CTC TCC CCT GTT GAA GCT C-3'). Le fragment
30 CD80 a été obtenu par réaction en chaîne par polymerase (PCR) en
utilisant des amorces spécifiques d'oligonucleotides
complémentaires aux extrémités 5' et 3' de la séquence
nucléotidique codant pour la partie extracellulaire de CD80
(Freeman G.J. et coll. J. Immunol. 143, (1989) 2714-2722). Ces
35 amorces ont également introduit un site de clivage EcoRI et54
BspEl (amorce 5'CD80 : 5' GCA GAA TTC ACC ATG GGC CAC ACA CGG
AGG CAG 3' ; amorce 3'CD80 : 5'TGG TCC GGA GTT ATC AGG AAA ATG
CTC TTG CTT G 3' ) . La matrice de cADN pour cette PCR a été
préparé par transcription inverse de l'ARN total préparé à
5 partir de la lignée de cellules Raji du lymphome de Burkitt
selon des procédures standard. (Sambrook, Molecular Cloning ; A
Laboratory Manual, 2nd Edition, Cold Spring Harbour Laboratory
Press, Cold Spring Harbour, New York (1989)).
La protéine co-stimulatrice de CD80 appartient à la superfamille
10 d'Ig. C'est une protéine lourdement glycosylée de 262 acides
aminés. Une description plus détaillée a été publiée par Freeman
G.J. et coll. J. Immunol. 143, (1989) 2714-2722).
La chaîne CD80-Ckappa a été clonée en plusieurs étapes en
utilisant le vecteur déjà existant pEF-DHFR-CTI-CD80-M79scFv. Ce
15 vecteur a été réalisé de la manière suivante. Tout d'abord, un
poly-linker désigné par CTI a été introduit dans le vecteur
Bluescript KS (numéro d'accès X52327 à GenBank®) en utilisant
les sites de clivage par enzymes de restriction Xbal et Sali
(Boehringer Mannheim). L'introduction du poly-linker CTI a
20 fourni des sites de clivage supplémentaires ainsi que la
séquence codant un fragment de liaison (Gly^Ser!)lr une étiquette
histidine à six acides aminés et un codon d'arrêt, comme indiqué
sur la figure 2. Le vecteur Bluescript KS-CTI a été préparé par
clivage avec les enzymes de restriction EcoRV et Xmal
25 (Boehringer Mannheim et New England Biolabs) afin de le lier (T4
DNA, Ligase Boehringer Mannheim) avec le fragment M7 9scFv clivé
par EcoRV et BspEl (Mack et coll. Proc. Natl. Acad. Sei. 92
(1995) 7021-7025). Le vecteur obtenu Bluescript KS-CTI-M79 scFv
a été à nouveau clivé avec EcoRI (Boehringer Mannheim) et BspEl
30 afin d'introduire le fragment d'ADN, obtenu par réaction en
chaîne par polymerase, de CD80, obtenu comme décrit précédemment
et clivé avec les mêmes enzymes. Ensuite, tout le fragment d'ADN
CD80-M79scFv (VL/VH) a été isolé par clivage du vecteur
BluescriptKS-CTI-M79scFv (VL/VH) avec Ecorl et Sali (Boehringer
35 Mannheim), puis introduit dans le vecteur d'expression55
eucaryotique pEF-DHFR, décrit par Mack et coll., Proc. Natl.
Acad. Sei. USA 92 (1995), 7021-7025)., contenant le gène
dihydrofolate reductase comme marqueur de sélection.
Pour 1'étape finale de réalisation de la chaîne CD80-Ckappa, le
5 fragment Ckappa obtenu comme décrit précédemment a été clivé
avec les enzymes de restriction BspEl et Sali et clone dans le
vecteur pEF-DHFR-CTI-M79scFv-CD80 en utilisant les mêmes
enzymes. De ce fait, le fragment M79scFv a été remplacé par
Ckappa. Le plasmide final pEF-DHFR-CTI-CD80-Ckappa représenté
10 sur la figure 3 a été linéarisé avec 1 ' enzyme de restriction
Ndel (Boehringer Mannheim) et transfecté dans des cellules CHO
par électroporation. Les conditions d'électroporation étaient
2 60 V/960 |iF, par utilisation d'un BioRad Gene Pulser?. Une
expression stable a été effectuée dans des cellules CHO
15 déficientes en dihydrofolate reductase, comme décrit par
Kaufmann R.J. et coll. (1997) Methods Enzymol. 185, 537-566. Les
cellules ont été cultivées pour sélection dans un milieu a-MEM
sans nucleoside, supplémenté par 10 % de sérum f?tal de veau
dialyse, 2 mM de L-glutamine, 100 U/ml de pénicilline et 100
20 ng/ml de streptomycine.
Exemple 1.1.2 : Réalisation de la chaîne M79scFv-CHl
A l'étape suivante, la chaîne M79scFv-CHl a été assemblée. Le
fragment CHI de la chaîne lourde d'IgGl humaine a été amplifié
par réaction en chaîne par polymerase à partir de la même
25 matrice de cADN que celle utilisée pour l'amplification du
domaine de Ckappa humaine par réaction en chaîne par polymerase.
L'amorce 5 ' de réaction en chaîne par polymerase a introduit
deux sites de clivage (BspEl et Nhel) ainsi que la région
charnière supérieure d'IgG3 humaine (5'CHlhuGlBspEl : AAT TCC
30 GGA ACC CCG CTG GGT GAC ACC ACC CAC ACC GCT AGC ACC AAG GGC CCA
TCG GTC TTC C). L'amorce 3' de réaction en chaîne par polymerase
a introduit les sites de clivage BspEl et Spel (3'CHlhuGlBspEl :
AAT TCC GGA ACT AGT TTT GTC ACA AGA TTT GG) Le fragment obtenu
par réaction en chaîne par polymerase a été préparé pour clonage
35 par clivage avec 1'enzyme de restriction BspEl et inséré dans le56
vecteur BS-CTI décrit précédemment, qui était clivé avec BspEl
et Xmal. Pour éviter 1'auto-ligation du vecteur, celui-ci a été
traité par phosphatase alcaline. Ensuite, le fragment CHI a été
excisé de BS-CTI avec les enzymes de restriction Sali et BspEl
5 afin de le relier avec le fragment Fv simple chaîne M79, comme
décrit ci-après:
L'anticorps M79 a été décrit par Göttlinger et coll. (1986),
Int. J. Cancer 38, 47-53. Le fragment M79 scFv a été obtenu à
partir de l'anticorps bispécifique simple chaîne (M79scFv-
10 antiCD3scFv) décrit par Mack et coll., Proc. Natl. Acad. Sei. 92
(1995), 7021-7025. Le fragment d'ADN codant cet anticorps
bispécifique simple chaîne a été excisé à partir du vecteur
d ' expression pEF-DHFR et introduit dans le vecteur d'expression
pEF-ADA en utilisant les enzymes de restriction EcoRI et Sali
15 respectivement. Le vecteur d'expression pEF-ADA a été dérivé du
vecteur d'expression pEF-DHFR (Mack et coll., Proc. Natl. Acad.
Sei. USA 92 (1995), 7021-7025) en remplaçant le cADN codant pour
la dihydrofolate reductase de souris par celui codant pour la
désaminase de souris.
20 Afin d'introduire le fragment CHI et de remplacer ainsi le
fragment anti-CD3scFv, le vecteur pEF-ADA contenant l'anticorps
bispécifique simple chaîne M79scFv- antiCD3scFv a été clivé au
moyen des mêmes enzymes de restriction que pour la préparation
du fragment CHI (BspEl, Sali). Le plasmide obtenu pEF-ADA-
25 M7 9scFv-CHl représenté sur la figure 3 a été linéarisé avec Ndel
et transfecté dans des cellules CHO déjà transfectées avec le
vecteur d'expression pEF-DHFR-CTI-CD80-Ck. Les cellules
doublement transfectées ont été cultivées pour sélection dans un
milieu a-MEM sans nucleoside, supplémenté par 10 % de sérum
30 f?tal de veau dialyse, 2 mM de L-glutamine, 100 U/ml de
pénicilline, 100 ng/ml de streptomycine, 0,1 uM de
désoxycoformycine (dCF) et l'additif lxl.l-AAU tel que décrit
par Kaufmann R.J. (Meth. Enzym. 185 (1990) 537-566). Lorsque les
cellules ont été bien développées dans ces conditions, la
35 concentration de dCF a été augmentée à 0,3 nM (sélection d'ADA)57
et du methotrexate (MTX) a été ajouté à une concentration finale
de 20 nM (sélection de DHFR) afin d'obtenir des niveaux
d'expression plus élevés de 1'hétérominibody en raison de
1'amplification du gène. L'analyse par test ELISA du surnageant
5 de la culture des lignes de cellules transfectées a été
effectuée afin de déterminer le niveau d'expression de
1'hétérominibody et de confirmer sa spécificité de liaison pour
l'antigène 17-1A (voir exemple 4.4 et figures 9, 10).
Exemple 1.2.1 : hétérominibody M79scFvCK/CD80CKl
10 Une autre version de 1'hétérominibody CD80 a été réalisée en
remplaçant le fragment M79scFv et le fragment CD80 1 ' un par
1'autre. A cet effet, les deux plasmides d'expression pEF-DHFR-
CTI-CD80-Ck et pEF-ADA M79scFv-CHl ont été clivés avec EcoRI et
BspEl. Le fragment M79scFv a été ensuite lié avec le fragment
15 pEF-DHFR-CTI~CK et le fragment CD80 a été lié avec le fragment
pEF-ADA-CHl. Tout d'abord, le vecteur pEF-DHFR-M79scFv-CK a été
transfecté dans des cellules CHO et cultivé pour sélection comme
décrit dans 1 ' exemple 1.1 Le pEF-ADA-CD80-CHl a été transfecté
dans les mêmes cellules CHO dans une seconde étape et les
20 cellules CHO doublement transfectées obtenues ont été cultivées
pour sélection comme décrit précédemment (voir figures 1 et 3).
1.2.1 Amplification, sous-clonage et purification de
1'hétérominibody M79scFvCK/CD80CHl
La sélection primaire a été effectuée dans un milieu de culture
25 alpha-MEM sans nucleosides, supplémenté par 10 % de sérum f?tal
de veau dialyse et 0,1 jiM de désoxycoformycine (dCF) ainsi que
par l'additif lxl.l-AAU tel que décrit (Kaufmann, Methods
Enzymol. 185 (1990), 537-566). L'expression de cette
construction a été augmentée par amplification du gène induite
30 en augmentant pas à pas les concentrations du methotrexate (MTX)
inhibiteur de la dihydrofolate reductase et de la
désoxycoformycine (dCF) inhibitrice d'ADA.
Les étapes d'amplification individuelles ont été réalisées comme
suit :
35 1. Amplification 20 nM de MTX et 0,3 |iM de dCF,58
2. Amplification 100 uM de MTX et 1 uM de dCF
3. Amplification 500 nM de MTX et 3 (iM de dCF. Les cellules
obtenues par la troisième étape d'amplification ont été clonées
en limitant la dilution. Dans ce but, les cellules ont été
5 semées à une concentration de 50 cellules par ml, 10 cellules
par ml et 2 cellules par ml dans des plaques 96 puits à fond
plat pour culture de tissus selon les Current Protocols in
Immunology (Coligan, Kruisbeek, Margulies, Shevach et Strober,
Wiley-Interscience, 1992) dans les conditions de culture de la
10 troisième étape d'amplification. Des clones positifs dans des
puits avec simple amas serré de cellules, comme preuve de la
croissance monoclonale, ont été identifiés par test ELISA, comme
décrit dans l'exemple 2.1.
Un clone positif a été développé et pris pour la production de
15 protéines. Une production d'anticorps à grande échelle a été
réalisée dans des flacons à bille en utilisant 500 ml de milieu.
L'hétérominibody M79scFvCK/CD80CHl a été purifié par
l'intermédiaire de sa queue d'histidine C-terminale, comme cela
a été décrit (Mack et coll., Proc. Natl. Acad. Sei. USA 92
20 (1995), 7021-7025).
Exemple 1.2.3 : Test ELISA sur surnageant de culture cellulaire
d'hétérominibodies CD80
Pour analyser les propriétés de liaison à 17-1A des deux
versions d'hétérominibody CD80 et pour confirmer la parfaite
25 association de CHI et CK, deux analyses ELISA différentes ont
été réalisées. La liaison spécifique à l'antigène 17-1A a été
démontrée par incubation de surnageant de culture sur antigène
17-IA recombinant immobilisé et détection des hétérominibodies
CD80 liés, au moyen d'un anticorps anti CD80. La construction
30 hétérodimérique des hétérominibodies a été confirmée par
incubation du surnageant de culture sur anticorps anti étiquette
histidine immobilsé, suivie par une étape de détection avec un
anticorps anti Ckappa humain. Pour les détails des deux tests
ELISA, voir l'exemple 4.4, figures 9 et 10.59
Exemple 2 Analyse des hétérominibodies M79scFvCK/CD80CHl et
M79scPvCHl/CD8CK
2.1 Analyse par test ELISA de l'hétérominibody M79scFvCK/CD80CHl
exprimé par des lignées de cellules CHO transfectées à
5 différents stades de 1'amplification du gène
Les surnageants de culture correspondant à la sélection
primaire, à la première et deuxième amplifications et à la
troisième amplification plus clonage cellulaire consécutif ont
été soumis au test ELISA. Dans ce but, le 17-1A recombinant
10 (Mack, Proc. Natl. Acad. Sei. USA 92 (1995) , 7021-7 025) a été
placé sur des plaques ELISA 96 puits à fond en U (Nunc maxisorb)
(50 (ig/ml, 50 (il par puits) dans une solution saline tamponnée
par phosphate (PBS). Le recouvrement a été effectué durant la
nuit à 4°C, le blocage a été effectué avec 3 % de sérum-albumine
15 bovine (BSA) dans une solution saline tamponnée par phosphate
pendant une heure à la température ambiante. Les constructions
d'anticorps, en tant que surnageants de culture provenant de la
sélection primaire (PS) et des différentes étapes
d'amplification (1. Arap, 2. Amp, 3. Amp sous-clones) (figure 4),
20 respectivement, ont été ajoutées et incubées pendant une heure à
la température ambiante. L'hétérominibody lié a été détecté par
un anticorps anti CK humain étiqueté par biotine (Pierce, Cat.
31780) dilué à 1/1000 dans une solution saline tamponnée par
phosphate contenant 1 % de sérum-albumine bovine. Après lavage
25 trois fois avec la solution saline tamponnée par phosphate
Tween20 à 0,05 %, de la peroxydase d'avidine (DAKO Hambourg,
Cat. n° P0347), diluée à 1/1000, a été ajoutée et incubée à la
température ambiante pendant une heure. Après lavage quatre fois
avec la solution saline tamponnée par phosphate Tween20 à 0,05
30 %, le test ELISA a été finalement développé en ajoutant la
solution de substrat suivante : 22 mg de ABTS (sel de 2,2 azino-
bis (3-éthylbenzthiazoline-6 acide sulfonique) diammoniura) ont
été dissous dans 10 ml de tampon constitué par du citrate 0,1 M,
pH 5,1, contenant 2,3 mg de perborate de sodium tétrahydraté.
35 Pour les contrôles négatifs, les plaques ont été incubées avec60
la solution saline tamponnée par phosphate au lieu des
constructions d'anticorps bifonctionnels. Le précipité coloré a
été mesuré à 405 nm par un lecteur ELISA. Comme le montre la
figure 4, 1'expression d'hétérominibody a augmenté
5 continuellement depuis la sélection primaire jusqu'à un clone
cellulaire provenant du troisième stade d'amplification.
2.2 Analyse par test ELISA des hétérominibodies
M79scPvCK/CD80CHl et M79scFvCHl/CD8CK par différentes
combinaisons d'anticorps immobilisés ou d'antigène 17-1A
10 immobilisé avec anticorps de détection appropriés
2.2.1 Analyse par test ELISA avec antigène 17-lA immobilisé et
anticorps de détection anti CD80
Les surnageants de culture provenant du lcc stade d'amplification
ont été testés. L'antigène 17-lA recombinant a été placé sur une
15 plaque ELISA. Les constructions d'anticorps lié ont été
détectées par un anticorps monoclonal spécifique à CD80
(Immunotech, Cat. n° 1449) dilué à 1/1000 dans une solution
saline tamponnée par phosphate contenant 1 % de sérum-albumine
bovine, suivi par un anticorps polyclonal de chèvre anti IgG de
20 souris (spécifique Fc) conjugué à de la peroxydase, dilué à
1/1000 dans une solution saline tamponnée par phosphate
contenant 1 % de sérum-albumine bovine. Le test ELISA a été
effectué comme décrit précédemment. Comme le montre la figure 9,
les deux versions d'hétérominibody ont prouvé qu'elles lient
25 l'antigène 17-lA, bien que la version M79scFvCK/CD80CHl ait
montré un niveau d'expression nettement plus élevé que la
version M79scFvCHl/CD8CK.
2.2.2 Analyse par test ELISA avec anticorps anti étiquette
histamine immobilisé et anticorps de détection anti Cdappa humaine
30 Les surnageants de culture provenant du 1er stade d'amplification
ont été testés. Un anticorps anti étiquette histidine ne
contenant pas de sérum-albumine bovine (Dianova, Hambourg, Cat.
n° DIA910) a été placé sur une plaque ELISA. Les constructions
d'anticorps liés ont été détectées par un anticorps anti Cdappa
35 humaine étiqueté par biotine (Pierce, Cat. n° 31780), dilué à61
1/1000 dans une solution saline tamponnée par phosphate, suivie
par de la peroxydase d'avidine (DAKO Hambourg, Cat. n° P0347),
diluée à 1/1000, avec 1 % de sérum-albumine bovine. Le test
ELISA a été effectué comme décrit précédemment. Comme le montre
5 la figure 10, les résultats de ce test ELISA confirment le
niveau d'expression plus élevé de 1'hétérominibody
M79scFvCK/CD80CHl et, avec les résultats du test ELISA
précédent, démontrent clairement la structure hétérodimérique
des hétérominibodies CD80.
10 2.2.3 Analyse par test ELISA avec protéine de fusion CTLA-4-Ig
immobilisée et un anticorps de détection anti Ckappa humaine
Afin de démontrer l'interaction du bras (B7-1) CD80 de
1'hétérominibody M79scFvCK/CD80CHl avec son contre-récepteur
CTLA-4, une protéine de fusion CTLA-4-Ig du commerce (R&D
15 Systems, Minneapolis MN USA Cat. n° 325-CT) a été immobilisée
sur une plaque ELISA (concentration du recouvrement 10 ug/ml)
et, après blocage par solution saline tamponnée par phosphate
contenant 3 % de sérum-albumine bovine, incubée avec différentes
concentrations d'hétérominibody purifié (dans solution saline
20 tamponnée par phosphate contenant 3 % de sérum-albumine bovine)
; l'hétérominibody lié a été détecté par un anticorps anti Ckappa
humaine étiqueté par la biotine (Pierce, Cat. n° 31780), dilué à
1/1000 dans une solution saline tamponnée par phosphate
contenant 1 % de sérum-albumine bovine, suivie par de 1'avidine
25 conjuguée avec de la peroxydase. Comme contrôle négatif,
certains puits de la plaque ELISA ont été recouverts d'une
protéine de fusion CD4-Ig au lieu de la protéine de fusion CTLA-
4-Ig. Le test général ELISA a été effectué comme décrit
précédemment. Les résultats indiqués par la fig. 39 démontrent
30 clairement la liaison spécifique de 1'hétérominibody à la CTLA-4
humaine.
Exemple 2.3 : Gel SDS de protéine
Pour déterminer la taille de 1'hétérominibody purifié
M79scFvCK/CD80CHl, un SDS-PAGE a été réalisé avec un gel de
35 Polyacrylamide à 10 % dans des conditions non réductrices et62
réductrices selon Laemmli (Laemmli, Nature 227 (1970), n' 259
680-5), avec ensuite coloration des protéines avec ROTI®-Blue
(Carl Roth GmbH + Co, Karlsruhe, Allemagne ; Cat. n° A152.1) .
Par comparaison au standard moléculaire utilisé (marqueur de
5 poids moléculaire de protéine colorée Rainbow1*', gamme 14.300 -
2.200.000, Amersham LIFESCIENCE, Brunswick, Allemagne, Cat. n°
RPN 756), une bande distincte de protéine était visible dans les
conditions non réductrices à environ 115 kD, ce qui concorde
avec le poids moléculaire prévu. Dans les conditions
10 réductrices, deux bandes d'environ 40 kD sont apparues,
correspondant au bras M7 9scFvCK de 1'hétérominibody et d'environ
60 kD correspondant au bras CD80CH1 de 1'hétérominibody. Ainsi,
une liaison covalente des deux bras de 1'hétérominibody par
l'intermédiaire d'un pont disulfure a pu être confirmée, avec la
15 bande de 60 KD "barbouillée" démontrant la glycosylation du
domaines extracellulaires CD80.
Exemple 2.4 : Analyse de 1'hétérominibody M79scFvCK/CD80CHl par
cytométrie en flux
La liaison de 1'hétérominibody M79scFvCK/CD80CHl à l'antigène
20 17-lA natif a été analysée par cytométrie en flux. 200.000
cellules CHO transfectées par 17-lA (voir exemple 5.1) ont été
incubées pendant 30 minutes avec plusieurs dilutions
d'hétérominibody purifié allant de 4 ug/ml à 3,9 ng/ml. Ensuite,
les cellules ont été lavées deux fois dans une solution saline
25 tamponnée par phosphate et incubées encore 30 minutes avec un
anticorps murin anti CD80 humain, conjugué avec R-phycoérythrine
(Becton Dickinson Immunocytometry Systems, San Jose CA, USA, Cat
n° 340294). Après deux étapes finales de lavage dans une
solution saline tamponnée par phosphate, les cellules ont été
30 analysées par cytométrie en flux (FACS-SCAN Becton Dickinson
Immunocytometry Systems, San Jose CA, USA). Résultats, voir
figure 5.
A titre d'alternative, des cellules CHO transfectées par 17-lA
ont été incubées pendant 30 minutes sur de la glace avec
35 hétérominibody M79scFvCK/CD80CHl purifié, à une concentration de63
0,2 mg/ml. Après lavage dans une solution saline tamponnée par
phosphate, les cellules été incubées pendant 30 minutes sur de
la glace avec un anticorps anti Ckappa humaine, conjugué avec de
1'isothiocyanate de fluorescéine (Coulter, Cat. n° 6604287)
5 dilué à 1/10, lavées à nouveau dans une solution saline
tamponnée par phosphate, puis soumises à la cytométrie en flux ;
le résultat est indiqué par la figure 37.
Afin de démontrer l'interaction du bras (B7-1) CD80 de
1'hétérominibody M79scFvCK/CD80CHl avec son contre-récepteur
10 CD28, une analyse par cytométrie en flux sur cellules CD8+CD11B-T
naïves, isolées dans l'exemple 6.1, a été réalisée ; la
cytométrie en flux standard a confirmé que les cellules
expriment CD28, mais non CTLA-4, 1'autre contre-récepteur de
CD80. Ensuite, les cellules CD8+CD11B-T naïves ont été incubées
15 pendant 30 minutes sur de la glace avec hétérominibody
M79scFvCK/CD80CHl purifié, à une concentration de 0,2 mg/ml.
Après lavage dans une solution saline tamponnée par phosphate,
les cellules été incubées pendant 30 minutes sur de la glace
avec un anticorps anti Ckappa humaine, conjugué avec de
20 1'isothiocyanate de fluorescéine (Coulter, Cat. n° 6604287)
dilué à 1/10, lavées à nouveau dans une solution saline
tamponnée par phosphate, puis soumises à la cytométrie en flux.
Le résultat indiqué par la fig. 38 démontre la liaison de
1'hétérominibody M79scFvCK/CD80CHl à CD28 ; la spécificité de la
25 liaison a été confirmée en bloquant le signal de fluorescence au
moyen d'une protéine commerciale de fusion CTLA-4-Ig (R&D
Systems, Minneapolis MN USA Cat. n° 325-CT).
Exemple 3 : Constructions d'hétérominibodies CD80-antiLeyscFv
3.1 Construction d'hétérominibody antiLeyscFvCHl/CD80CK
30 Un hétérominibody CD80 avec une autre spécificité d'antigène
(anti-LewisY(LeY) a été réalisé en remplaçant la région M79scFv
de liaison à 1'antigène, spécifique à 17-lA, par le fragment
scFv d ' un anticorps monoclonal de souris, dirigé contre
1'antigène LewisY (LeY), exprimé sur de nombreuses cellules
35 tumorales epitheliales. Pour la stratégie de réalisation, voir64
figures 1 et 3. Pour générer la chaîne antiLeyscFvCHl, le
vecteur pEF-ADA-M79scFv-CHl décrit dans 1'exemple 1.1.2 et
représenté sur la figure 3 a été clivé avec les enzymes de
restriction EcoRI et BspEl, en libérant ainsi le fragment
5 M7 9scFv incluant la séquence leader eucaryote N-terminale. Ce
fragment scFv a ensuite été remplacé par celui de 1'anticorps
spécifique à LeY portant également un leader eucaryotique sur
son extrémité N-terminale. La séquence du fragment correspondant
EcoRl/BspEl-DNA est représentée par la figure 6. Le sous-clonage
10 a été réalisé dans la souche d'E. coli, blue XL-1, selon les
méthodes standard (Sambrook, Molecular Cloning: A Laboratory
Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, New York, 1989). Le plasmide d'expression obtenu
pEF-ADA-anti LeYscFv-CHl a été linéarisé avec Ndel et transfecté
15 dans des cellules CHO qui étaient déjà transfectées avec le
plasmide d'expression pEF-DHFR-CTI-CD80-Ckappa décrit dans
1'exemple 1 et représenté sur la figure 7. La sélection primaire
des doubles transfectants obtenus a été réalisée comme décrit
dans 1'exemple 1. L'expression de 1'hétérominibody anti-
20 LeYscFvCHl/CD80CK a été accrue ensuite par amplification du gène
induite par methotrexate (MTX), inhibiteur de la dihydrofolate
reductase, à une concentration finale de 20 nM, et augmentation
de la désoxycoformycine (dCF) à une concentration finale de 0,3
uM, telle que décrite (Kaufmann, Methods Enzymol. 185 (1990),
25 537-566).
3.2 Hétérominibody antiLeyscFvCK/CD80CHl
Pour la réalisation de 1'hétérominibody antiLeyscFvCK/CD80CHl,
le fragment M79scFv a été excisé à partir du vecteur pEF-DHFR-
M79scFv-CK décrit dans 1'exemple 1, au moyen des enzymes de
30 restriction EcoRI et BspEl et remplacé par le fragment
EcoRl/BspEl de la région de liaison à un antigène de l'anticorps
spécifique à LeY, comme le montre la figure 6. Le sous-clonage a
été réalisé dans la souche d'E. coli, blue XL-1, selon les
méthodes standard (Sambrook, Molecular Cloning: A Laboratory
35 Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold65
Spring Harbor, New York, 1989). Le plasmide d'expression obtenu
pEF-DHFR-antiLeYscFv-CK a été transfecté dans des cellules CHO,
avec ensuite transfection du plasmide d'expression pEF-ADA-CD80-
CH1 décrit dans l'exemple 1. Afin d'accroître l'expression de
5 1'hétérominibody antiLeYscFvCK/CD80CHl, l'amplification du gène
a été réalisée comme décrit précédemment pour 1'hétérominibody
anti-LeYscFvCHl/CD80CK.
3.3.1 Analyse par test ELISA de l'hétérominibody
antiLeyscFvCK/CD80CHl et de 1'hétérominibody anti-
10 LeYscFvCHl/CD80CK avec conjugué immobilisé LeY/sérum-albumine
bovine et un anticorps de détection anti CD80
Les surnageants de culture des transfectants correspondants
récoltés après le premier stade d'amplification du gène ont été
soumis au test ELISA. Dans ce but, un conjugué d'antigène
15 synthétique Lewis Y avec de la sérum-albumine bovine (ou BSA) du
commerce (Alberta Research Council, Canada) a été placé sur des
plaques ELISA 96 puits à fond en U (Nunc maxisorb) (30 ug/ml, 50
ul par puits) dans une solution saline tamponnée par phosphate.
Le recouvrement a été effectué durant la nuit à 4°C, le blocage
20 a été effectué avec 3 % de sérum-albumine bovine dans une
solution saline tamponnée par phosphate pendant une heure à la
température ambiante. Les surnageants de culture provenant du
premier stade d'amplification (1.Amp.) (figure 7) ont été
ajoutés et incubés pendant une heure à la température ambiante à
25 différentes dilutions dans une solution saline tamponnée par
phosphate contenant 1 % de sérum-albumine bovine.
Les hétérominibodies liés ont été détectés par un anticorps
monoclonal spécifique de CD80 (Immunotech, Cat. n° 1449) dilué à
1/1000 dans une solution saline tamponnée par phosphate
30 contenant 1 % de sérum-albumine bovine. Après lavage trois fois
avec la solution saline tamponnée par phosphate Tween20 à
0,05%, un anticorps polyclonal de chèvre anti IgG de souris
(spécifique Fc) conjugué à de la peroxydase, dilué à 1/5000 a
été ajouté et incubé à la température ambiante pendant une
35 heure. Après lavage quatre fois avec la solution saline66
tamponnée par phosphate Tween20 à 0,05 %, le test ELISA a
finalement été développé en ajoutant la solution de substrat
suivante : 22 mg de ABTS (sel de 2,2 Azino-bis (3-
(éthylbenzthiazoline-6 acide sulfonique) diammonium) dissous
5 dans 10 ml de tampon constitué par du citrate 0,1 M, pH 5,1,
contenant 2,3 mg de perborate de sodium tétrahydraté. Pour les
contrôles négatifs, les plaques ont été incubées avec la
solution saline tamponnée par phosphate au lieu des surnageants
de culture. Le précipité coloré a été mesuré à 405 nm par un
10 lecteur ELISA. Les résultats indiqués par la figure 7 démontrent
la spécificité des deux versions d'hétérominibody pour
l'antigène LeY et leur structure hétérodimère.
3.3.2 Analyse par test ELISA de l'hétérominibody
antiLeyscFVCK/CD80CHl et de 1'hétérominibody anti-
15 LeYscFvCHl/CD80CK avec l'anticorps immobilisé anti étiquette
histidine et un anticorps de détection anti Ckappa humaine des
transfectants correspondants récoltés après le premier stade
d'amplification de gène de construits utilisant le recouvrement
par l'histidine
20 Les surnageants de culture ont été soumis au test ELISA. Dans ce
but, un anticorps anti étiquette histidine, sans sérum-albumine
bovine, (Dianova, Cat. n° 910) , a été placé sur des plaques
ELISA 96 puits à fond en U (Nunc maxisorb) (25 ug/ml, 50 (il par
puits) dans une solution saline tamponnée par du phosphate
25 (PBS) . Le recouvrement a été effectué durant la nuit à 4°C, le
blocage a été effectué avec 3 % de sérum-albumine bovine dans
une solution saline tamponnée par phosphate pendant une heure à
la température ambiante. Les surnageants de culture provenant du
premier stade d'amplification (l.Amp.) (figure 8) ont été
30 ajoutés et incubés pendant une heure à la température ambiante à
différentes dilutions dans une solution saline tamponnée par
phosphate contenant 1 % de sérum-albumine bovine.
Les hétérominibodies liés ont été détectées par un anticorps
anti Ckappa humaine étiqueté par la biotine (Pierce, Cat. n°
35 31780), dilué à 1/1000 dans une solution saline tamponnée par67
phosphate contenant 1 % de sérum-albumine bovine. Après lavage
trois fois avec la solution saline tamponnée par phosphate
Tween20 à 0,05%, de 1'avidine conjuguée avec de la peroxydase
(DAKO, Hambourg, Cat. n° P0347) a été ajoutée et incubée à la
5 température ambiante pendant une heure. Après lavage quatre fois
avec la solution saline tamponnée par phosphate Tween20 à
0,05 %, le test ELISA a finalement été développé en ajoutant la
solution de substrat suivante : 22 mg de ABTS (sel de 2,2 azino-
bis (3-éthylbenzthiazoline-6 acide sulfonique) diammonium)
10 dissous dans 10 ml de tampon constitué par du citrate 0,1 M, pH
5,1, contenant 2,3 mg de perborate de soude tétrahydraté. Pour
les contrôles négatifs, les plaques ont été incubées avec la
solution saline tamponnée par phosphate au lieu du surnageant de
culture. Le précipité coloré a été mesuré à 405 nm par un
15 lecteur ELISA. Les résultats indiqués par la figure 8 confirment
les résultats du test ELISA précédent.
Exemple 4 : Construction des hétérominibodies M79scFv avec
différentes protéines co-stimulatrices (CD54, CD58, C086)
Des hétérominibodies contenant trois autres protéines co-
20 stimularices (CD86) ou d'adhésion (CD54, CD58) ont été
construits. CD54, CD58, CD86 ont été introduits dans les deux
versions d'hétérominibodies (voir exemples 1.1 et 1.2). Les
fragments CD54, CD58 et CD86 ont été obtenus par réaction en
chaîne par polymerase (PCR) en utilisant des amorces
25 d'oligonucléides spécifiques, complémentaires aux extrémités 5 '
et 3' de la séquence de nucleotide codant pour la partie
extracellulaire de ces protéines. La matrice ADNc utilisée pour
ces réactions en chaîne par polymerase a été préparée par
transcription inverse de l'ARN total préparé à partir de
30 différentes lignes de cellules, comme mentionné ci-après, selon
des procédures standard. (Sambrook, Molecular Cloning ; A
Laboratory Manual, 2nd Edition, Cold Spring Harbour Laboratory
Press, Cold Spring Harbour, New York (1989)).
4.1 Construction de deux versions d'hétérominibody M79scPv-CD5468
Les hétérominibodies CD54 ont été réalisés en remplaçant la
partie extracellulaire de CD80, à 1'intérieur des
hétérominibodies décrits dans 1'exemple 1, par celle de CD54
(figure 1). La stratégie de réalisation est décrite ci-après.
5 4.1.1 Construction de 1'hétérominibody M79scFvCHl/CD54CK
L'antigène CD54 connu sous le nom de ICAM-1 (molécule d'adhésion
intracellulaire 1) appartient à la superfamille d'Ig. C'est une
protéine lourdement glycosylée qui est exprimée sur de
nombreuses cellules lymphoïdes, par exemple cellules
10 dendritiques. Une description plus détaillée a été publiée par
Simmons D. et coll. Nature 331 (1987) 624-626. La matrice d'ADNc
a été obtenue par transcription inverse de 1'ARN total provenant
de cellules HL-60 stimulées par TPA. Pour amplifier le domaine
extracellulaire de CD54, des amorces spécifiques pour les
15 extrémités 5' et 3' ont été utilisées. Ces amorces ont également
introduit les sites de clivage de restriction EcoRI et BspEl (5'
ICAM : CTC GAA TTC ACT ATG GCT CCC AGC AGC CCC CG et 3'ICAM :
GAT TCC GGA CTC ATA CCG GGG GGA GAG CAC) . La suite de la
procédure de clonage et d'expression a été la même que celle
20 décrite dans 1'exemple 1.1 pour 1'hétérominibody correspondant
CD80, donnant des cellules CHO doublement transfectées (pEF-ADA
M79scFvCHl, pEF-DHFR-CTI-CD54-CK, figure 3) qui ont montré
qu'elles sécrètent 1'hétérominibody CD54 dans le milieu de
culture cellulaire.
25 4.1.2 Construction de 1'hétérominibody M79scFvCK/CD54CHl
Une autre version de l'hétérominibody CD54 a été réalisée en
remplaçant le fragment M79scFv et le fragment CD54 l'un par
1'autre. A cet effet, les deux plasmides d'expression pEF-DHFR-
CTI-CD54-CK et pEF-ADA-M79scFv-CHl décrits précédemment ont été
30 clivés avec Ndel et BspEl, respectivement. Le fragment contenant
CD54 a été clone dans le fragment du vecteur pEF-ADA contenant
CHI. Le plasmide d'expression obtenu pEF-ADA-CD54-CHl (figure 3)
a été transfecté dans des cellules CHO (voir exemple 1.2.1) déjà
transfectées avec pEF-DHFR-M79scFv-CK (figure 3) comme décrit69
dans l'exemple 1.1.1. Les cellules CHO doublement transfectées
ont été cultivées pour sélection comme décrit dans l'exemple 1.
Exemple 4.1.3 : Test ELISA sur surnageants de culture cellulaire
d'hétérominibodies M79scFv-CD54
5 Pour analyser la spécificité de liaison à 17-lA des deux
versions d'hétérominibody CD54 et pour confirmer 1'association
adéquate de CHI et CK, deux tests ELISA différents ont été
réalisés. La liaison spécifique à 1'antigène 17-lA et la
structure hétérodimérique des hétérominibodies ont été
10 démontrées par incubation du surnageant de culture sur antigène
17-lA recombinant immobilisé et détection des hétérominibodies
CD54 liés, effectuée au moyen d'un anticorps anti CD54. La
structure hétérodimérique des hétérominibodies a été confirmée
également par incubation du surnageant de culture sur anticorps
15 immobilisé anti étiquette histidine au moyen d'une étape de
détection avec un anticorps anti Ckappa humaine. Pour les détails
des deux tests ELISA, voir exemple 4.4, figures 9 et 10.
4.2 Construction des deux versions d'hétérominibody M79scFv-CD58
Les hétérominibodies CD58 ont été construits en remplaçant la
20 partie extracellulaire du CD80, à l'intérieur des
hétérominibodies décrits dans 1'exemple 1, par celle de CD58
(figure 1). La stratégie de réalisation est décrite ci-après.
4.2.1 Construction de 1'hétérominibody M79scFvCHl/CD58CK
CD58, connu aussi sous le nom de LFA-3 (antigène associé à la
25 fonction lymphocyte) est une protéine appartenant à la
superfamille d'Ig et est le contre-récepteur de CD2. Une
description plus détaillée a été publiée par WalIner B. P, et
coll. J. Exp. Med 166 (1987) 923-932). La matrice d'ADNc a été
obtenue par transcription inverse de l'ARN total provenant de
30 cellules U937. Pour amplifier le domaine extracellulaire de CD58
et pour introduire les sites de clivage par enzymes de
restriction Xbal et BspEl, des amorces spécifiques 5' et 3' ont
été utilisées (5' LFA-3 AA TCT AGA ACC ATG GTT GCT GGG AGC GAC G
et 3'LFA-3 AAG TCC GGA TCT GTG TCT TGA ATG ACC GCT GC). La suite
35 de la procédure de clonage et d ' expression a été la même que70
celle décrite dans l'exemple 1, sauf que Xbal a été utilisé au
lieu de EcoRI en raison d'un site EcoRI interne à l'intérieur du
fragment d'ADN de CD58 et une souche d'E.coli déficiente en dam
méthyläse a été utilisée afin d'empêcher le blocage du site
5 BspEl à l'extrémité 3' du fragment CD58 en raison d'un site dam
superposé. Les cellules CHO doublement transfectées finalement
obtenues (pEF-ADA M79scFv-CHl, pEF-DHFR-CTI-CD58-CK, voir figure
3} se sont avérées sécréter l'hétérominibody CD58 dans le milieu
de culture cellulaire.
10 4.2.2 Construction de 1'hétérominibody M79scFvCK/CD58CHl
Une autre version de 1'hétérominibody CD58 a été construite en
remplaçant le fragment M7 9scFv et le fragment CD58 l'un par
l'autre (voir figure 1). A cet effet, deux plasmides
d'expression pEF-DHFR-CTI-CD58-CK et pEF-ADA-M7 9scFv-CHl décrits
15 précédemment ont été clivés avec Ndel et BspEl, respectivement.
Le fragment contenant CD58 a été clone dans le fragment du
vecteur pEF-ADA contenant CHI. Le plasmide d'expression obtenu
PEF-ADA-CD58-CH1 (figure 3) a été transfecté dans des cellules
CHO déjà transfectées avec pEF-DHFR-M79scFv-CK comme décrit dans
20 1'exemple 1. Les cellules CHO doublement transfectées ont été
cultivées pour sélection comme décrit dans l'exemple 1.
4.2.3 Test ELISA sur surnageants de culture cellulaire
d'hétérominibodies anti-M79scFv-CD58
Pour analyser la spécificité de liaison à 17-lA des deux
25 versions d'hétérominibody CD58 et pour confirmer l'association
adéquate de CHI et CK, deux tests ELISA différents ont été
réalisés. La liaison spécifique à 1'antigène 17-lA et la
structure hétérodimère des hétérominibodies ont été démontrées
par incubation du surnageant de culture sur antigène 17-lA
30 recombinant immobilisé et détection des hétérominibodies CD58
liés, effectuée au moyen d'un anticorps anti CD58. La structure
hétérodimérique des hétérominibodies a été confirmée par
incubation du surnageant de culture sur anticorps immobilisé
anti étiquette histidine suivie par une étape de détection avec71
un anticorps anti Ckappa humaine. Pour les détails des deux tests
ELISA, voir exemple 4.4.
4.3 Construction des deux versions d'hétérominibody M79scFv-CD86
Les hétérominibodies CD8 6 ont été construits en remplaçant la
5 partie extracellulaire du CD80, à l'intérieur des
hétérominibodies décrits dans 1'exemple 1, par celle de CD8 6
(figure 1). La stratégie de réalisation est décrite ci-après.
4.3.1 Construction de 1'hétérominibody M79scPvCHl/CD86CK
La protéine co-stimulatrice CD8 6, connue également sous le nom
10 de B7-2, appartient à la superfamille d'Ig. C'est une protéine
lourdement glycosylée de 306 acides aminés. Une description plus
détaillée a été publiée par Freeman G.J. et coli. Science 262
(1993) 909-911. La matrice d'ADNc a été obtenue par
transcription inverse de 1'ARN total provenant de la ligne Raji
15 de cellules de lymphome de Burkitt. Pour amplifier le domaine
extracellulaire de CD86, des amorces 5' et 3' spécifiques de
CD86 ont été utilisées (5'B7-2 : 5 ' AAG TCT AGA AAA TGG ATC CCC
AGT GCA CTA TG3', 3'B7-2 : 5'AAT TCC GGA TGG GGG AGG CTG AGG GTC
CTC AAG C3 ' ) ont été utilisés. Ces amorces introduisent
20 également des sites de clivage Xbal et BspEl, qui ont été
utilisés pour cloner le fragment PCR de CD8 6 dans le vecteur
Bluescript KS-CTI-M79scFv. La suite de la procédure de clonage
et d'expression a été la même que celle décrite dans l'exemple
1, sauf que Xbal a été utilisé au lieu de EcoRI en raison d'un
25 site EcoRI interne à 1 ' intérieur du fragment ADN de CD86. Les
cellules CHO doublement transfectées finalement obtenues (pEF-
ADA M79scFv-CHl, pEF-DHFR-CTI-CD86-CK, ) se sont avérées sécréter
1'hétérominibody CD86 dans le milieu de culture cellulaire.
4.3.2 Construction de 1'hétérominibody M79scFvCK/CD86CHl
30 Une autre version de 1'hétérominibody CD86 a été réalisée en
remplaçant le fragment M79scFv et le fragment CD86 l'un par
l'autre (voir figure 1). A cet effet, les deux plasmides
d'expression pEF-DHFR-CTI-CD86-CK et pEF-ADA-M79scFv-CHl ont été
clivés avec Ndel et BspEl, respectivement. Le fragment contenant
35 CD86 a été clone dans le fragment du vecteur pEF-ADA contenant72
CHI. Le plasmide d'expression obtenu pEF-ADA-CD86-CHl (figure 3)
a été transfecté dans des cellules CHO déjà transfectées avec
pEF-DHFR-M7 9scFv-CK (figure 3) comme décrit dans l'exemple 1.
Les cellules CHO doublement transfectées (pEF-DHFR-M7 9scFv-CK,
5 pEF-ADA-CD86-CHl, figure 3) ont été cultivées pour sélection
comme décrit dans l'exemple 1.
Exemple 4.3.3 : Test ELISA sur surnageant de culture cellulaire
d'hétérominibody CD86
Pour analyser la spécificité de liaison à 17-lA des versions
10 d'hétérominibody CD86 et pour confirmer l'association adéquate
de CHI et CK, deux tests ELISA différents ont été réalisés. La
liaison spécifique à 1'antigène 17-lA et la structure
hétérodimérique des hétérominibodies ont été démontrées par
incubation du surnageant de culture sur antigène 17-lA
15 recombinant immobilisé et détection des hétérominibodies CD86
liés, effectuée au moyen d'un anticorps anti CD8 6. La structure
hétérodimérique des hétérominibodies a été confirmée également
par incubation du surnageant de culture sur anticorps immobilisé
anti étiquette histidine au moyen d'une étape de détection avec
20 un anticorps anti Ckappa humaine. Pour les détails des deux tests
ELISA, voir exemple 4.4, figures 9 et 10.
Exemple 4,4 : Test ELISA sur surnageants de culture cellulaire
d'hétérominibodies M79scFv
Deux tests ELISA différents ont été réalisés sur surnageants de
25 culture cellulaire pour chaque hétérominibody M79scFv :
La liaison à 1'antigène 17-lA a été analysée au moyen de
1'antigène 17-lA recombinant obtenu par expression stable dans
des cellules CHO, telle qu'elle a été décrite (Mack et coll.,
Proc. Natl. Acad. Sei. USA 92 (1995), 7021-7025). L'antigène
30 recombinant est composé des 264 premiers acides aminés de
1'antigène 17-lA natif, connu également sous le nom de GA 733-2
(Scala, Proc. Natl. Acad. Sei. 87 (1990), 3542-3546), suivis
d'un codon d'arrêt. L'antigène a été immobilisé sur des plaques
ELISA 96 puits à fond en U (Nunc maxisorb) à une concentration
35 de 50 ug/ml de solution saline tamponnée par phosphate. Le73
recouvrement a été réalisé à 4°C pendant 12 heures avec 50 (il,
suivi par lavage une fois avec la solution saline tamponnée par
phosphate Tween à 0,05 %. Le test ELISA a été bloqué ensuite
pendant 1 heure avec une solution saline tamponnée par phosphate
5 contenant 3 % de sérum-albumine bovine et lavé à nouveau une
fois. Ensuite, le surnageant de culture cellulaire a été ajouté
non dilué et à plusieurs dilutions, et incubé pendant 2 heures.
La détection spécifique a été fonction du type de protéines co-
stimulatrices associées aux différentes versions
10 d'hétérominibody. Le tableau 1 indique les anticorps spécifiques
et les dilutions adoptées. Après lavage trois fois avec la
solution saline tamponnée par phosphate Tween20 à 0,05 %, un
anticorps polyclonal de chèvre anti IgG de souris (spécifique
Fc) conjugué à de la peroxydase a été ajouté et incubé à la
15 température ambiante pendant une heure. Après lavage quatre fois
avec la solution saline tamponnée par phosphate Tween20 à 0,05
%, le test ELISA a été finalement développé en ajoutant la
solution de substrat suivante : 22 mg de ABTS (sel de 2,2 azino-
bis (3-éthylbenzthiazoline-6 acide sulfonique) diammonium) ont
20 été dissous dans 10 ml de tampon constitué par du citrate 0,1 M,
pH 5,1, contenant 2,3 mg de perborate de sodium tétrahydraté.
Pour les contrôles négatifs, les plaques ont été incubées avec
la solution saline tamponnée par phosphate au lieu des
surnageants de culture. Le précipité coloré a été mesuré à 4 05
25 nm par un lecteur ELISA (figure 9) . Les résultats indiqués par
la figure 9 démontrent clairement que chacun des
hétérominibodies M79scFv réalisés a pu être détecté en tant
qu'hétérodimère totalement fonctionnel dans le surnageant des
transfectants correspondants.
30 Pour le second test ELISA, un anticorps anti étiquette histidine
(DIANOVA, Hambourg, Cat. n° DIA 910), dilué à 1/40, a été placé
sur des plaques 96 puits comme décrit précédemment. Les
surnageants de toutes les versions d'hétérominibody ont été
ajoutés purs et dans plusieurs dilutions. Un anticorps anti
35 Ckappa humaine biotinylé, suivi par de la streptavidine74
conjuguée à de la peroxydase (1/1000) (DAKO, Habourg, Cat. n°
P0347), a été utilisé pour la détection des hétérominibodies
liés (voir tableau 1) . Le test ELISA a été développé comme
décrit précédemment. Pour les résultats, voir figure 10.
5 Exemple 5 : Stimulation de cellules T CD4+CD45RO- naives par
hétérominibody M79scFvCK/CD80CHl
Exemple 5.1 : Purification de CD4+CD45RO- naïf provenant de sang
périphérique de donneurs humains sains
Pour analyser la fonction biologique de 1'hétérominibody
10 M79scFvCK/CD80CHl, une expérience de stimulation de cellules T
CD4+ a été réalisée. Les cellules T CD4+CD45RO-, communément
considérées comme naïves, ont été isolées de sang périphérique
de donneurs sains, par sélection négative. Tout d'abord, les
cellules mononucléaires du sang périphérique (PBMC) ont été
15 isolées par gradient de densité Ficoll (Current Protocols of
Immunology, Coligan, Kruisbeek, Margulies, Shevach et Strober,
Wiley-Interscience, 1992). Après lavage des cellules trois fois
par solution saline tamponnée par phosphate supplémentée par 2 %
de sérum f?tal de veau (SFV) , les cellules T CD4+ ont été
20 purifiées au moyen de colonnes du commerce pour cellules T CD4+-
(R&D Systems, Minneapolis MN USA, Cat. n° HCD43) . Au stade
suivant, les cellules T CD4 5RO+ ont été retirées par Dynabeads
M4 50 paramagnétiques (Dynal, Hambourg, Cat. n° 110.02). A cet
effet, des cellules T CD4+ ont été incubées pendant 30 minutes
25 avec 1'anticorps murin anti CD45RO humaine (UHCL-1) à une
concentration de 10 (ig/ml. Ensuite, les cellules ont été lavées
deux fois, puis incubées pendant 30 minutes supplémentaires avec
des perles magnétiques conjuguées avec 1'anticorps M450 de
mouton anti IgGl de souris. Les cellules T CD4+CD45RO+ qui
30 étaient quantitativement attachées aux perles magnétiques ont
été retirées par application d'un aimant. Les cellules restantes
étaient CD4+ et CD45RO- à une pureté de 98 %, confirmée par
cytométrie en flux.75
Exemple 5.2 : Stimulation de cellules T CD4+CD45RO- naives par
incubation simultanée avec 1'hétérominibody M79scFvCK/CD80CHl
et/ou l'anticorps bispécifique simple chaîne M79scFv-antiCD3scFv
Des cellules T CD4+CD45RO- ont été purifiées comme décrit
5 précédemment. La stimulation a été réalisée sur des plaques 96
puits à fond plat TPP. Le test de stimulation a été réalisé de
la manière suivante. Des cellules CHO transfectées par 17-lA ont
été utilisées comme cellules stimulatrices. Cette ligne de
cellules transfectées par 17-lA a été générée par sous-clonage
10 d ' un fragment d'ADN codant pour la séquence complète d'acides
aminés de 1 ' antigène 17-lA, connu également sous le nom de GA
733-2 (Szala, Proc. Natl. Acad. Sei. USA 87 (1990), 3542-3546),
dans le vecteur d'expression eucaryotique pEFDHFR selon des
procédures standard. (Sambrook, Molecular Cloning ; A Laboratory
15 Manual, 2nd Edition, Cold Spring Harbour Laboratory Press, Cold
Spring Harbour, New York (1989)) ; la linéarisation du plasmide
obtenu, au moyen de l'enzyme de restriction Nde 1, puis la
transfection stable dans des cellules CHO déficientes en
dihydrofolate reductase, ont été réalisées comme décrit dans
20 1'exemple 1.1.1. L'expression de 17-lA transmembranaire a été
accrue par amplification du gène induite par addition pas à pas
de concentrations croissantes de methotrexate (MTX), inhibiteur
de dihydrofolate reductase, à une concentration finale de 500
nM, les étapes de concentration étant compris entre 20 nM et 100
25 nM (Kaufmann, Methods Enzymol. 185 (1990), 537-566). Ces
cellules ont été soumises à un test d'expression membranaire de
17-lA par cytométrie en flux en utilisant l'anticorps M79
monoclonal spécifique de 17-lA (Gôttlinger, Int. J. Cancer 38
(1986), 47-53) à une concentration de 10 ug/ml, suivi par un
30 anticorps polyclonal de chèvre anti IgG + IgM (H+L) de souris,
dilué à 1/100 dans une solution saline tamponnée par phosphate.
Comme contrôle négatif, des cellules CHO non transfectés ont été
utilisées, tandis que la ligne Kato de cellules du cancer de
l'estomac humain, positives pour 17-lA, obtenues auprès de76
l'ATCC, ont servi de contrôle positif. Les résultats sont
indiqués par la figure 11.
Avant d'utiliser ces cellules pour la stimulation de cellules T,
elles ont été irradiées par 14000 rad, lavées deux fois dans une
5 solution saline tamponnée par phosphate, contenant 2 % de sérum
f?tal de veau, comptées, diluées dans un milieu (voir détails
ci-après) et semées dans des plaques 96 puits en une quantité de
25.000 cellules par puits. 50.000 cellules T CD4+CD45RO ont été
ajoutées à chaque puits, en donnant un rapport cellules
10 T/celIules stimulatrices de 2/1. L'hétérominibody
M79scFvCK/CD80CHl et/où l'anticorps bispécifique simple chaîne
M7 9scFv-antiCD3scFv ont été ajoutés en plusieurs concentrations
comme indiqué sur le tableau 2. Les cellules ont été cultivées
dans un milieu RPMI-1640 supplémenté par 10 % de sérum AB
15 humain, 100 U/ml de pénicilline, 100 mg/ml de streptomycine, 2
mM de glutamine, 1 mM de pyruvate de sodium, 10 mM de tampon
HEPES, 50 fiM de mercaptoéthanol à 37°C, 6 % de C02 et à une
humidité de 100 % pendant max. 12 jours.
5.3 Test de prolifération de BrdU
20 Afin de mesurer la cinétique de prolifération des cellules T
CD4+CD45RO- stimulées simultanément par 1'hétérominibody
M79scFvCK/CD80CHl et l'anticorps bispécifique simple chaîne
M79scFv-antiCD3scFv ou stimulées seulement par l'anticorps
bispécifique simple chaîne, un test de prolifération de BrdU a
25 été réalisé. Voir les détails dans la description du produit de
Boehringer Mannheim, Cat. n° 1647229. Les résultats indiqués par
la figure 12 démontrent clairement une prolifération cellulaire
nettement accrue, induite par l'hétérominibody plus 1 '.anticorps
bispécifique simple chaîne, comparativement à celle induite
30 seulement par l'anticorps bispécifique simple chaîne.
5.4 Analyse par cytométrie de flux des cellules T CD4+CD45RO-
stimulées par 1'hétérominibody M79scFvCK/CD80CHl et/ou
l'anticorps bispécifique simple chaîne M79scFv-antiCD3scFv
Les niveaux d'expression de CD45RO et CD4 5RA sur des cellules T
35 stimulées ont été analysés par cytométrie de flux (FACS Scan,77
Becton Dickinson) les jours 3 et 6 de l'expérience de
stimulation. Les cellules T stimulées ainsi que les contrôles
(voir exemple 5.1) ont été incubés pendant 30 minutes avec
différentes combinaisons d'anticorps listées sur le tableau 4.
5 Les cellules T ont été incubées avec les trois combinaisons
suivantes d'anticorps : anti CD45RO FITC/anti CD45RA PE, anti
CD4 5RO FITC / Isotype IgGl PE, anti CD4 5RA PE/ Isotype IgG2a
FITC. Le pourcentage de cellules T amorcées qui sont passées au
phénotype de surface CD4 5RO+/CD4 5RA- en fonction des
10 concentrations de 1'hétérominibody et de 1'anticorps
bispécifique est indiqué par les figures 13 et 14, correspondant
à un temps de stimulation de 3 et 6 jours respectivement. Le
résultat final de la stimulation des cellules T après 6 jours
est également indiqué par la figure 33.
15 5.5 Analyse par test ELISA de INF-y dans du surnageant de culture
cellulaire de cellules T CD4+
Afin de confirmer l'amorçage in vitro de cellules T CD4+ par la
combinaison de 1'hétérominibody et de l'anticorps bispécifique
simple chaîne, la concentration de INF-y dans le surnageant de
20 culture de cellules T a été déterminée au moyen d'un test ELISA
semi-quantitafif de INF-y (Genzyme DuoSet, Genzyme Diagnostics
Cambridge, MA USA Cat. n° 80-3932-00) réalisé selon le manuel du
fabricant. Comme INF-y est sécrété typiquement par des cellules
TH1- amorcées, mais non des cellules T CD4+ naïves, les
25 résultats indiqués par les figures 15 et 16 démontrent que
l'amorçage des cellules T s'est produit en présence de
1'hétérominibody et de l'anticorps bispécifique simple chaîne,
mais non avec l'anticorps bispécifique seul. De plus, la
sécrétion de INF-y par les cellules T CD4+ amorcées indique
30 fortement la différenciation de ces cellules en phénotype TH1.
Exemple 5.6 : Analyse ELISA d'IL-5 dans un surnageant de culture
cellulaire de cellules T CD4+ stimulées
Un deuxième test ELISA a été effectué pour analyser la sécrétion
d'IL-5 par des cellules T CD4 + stimulées. Cependant, le test
35 ELISA d'IL-5 (Genzyme DuoSet, Genzyme Diagnostics Cambridge, MAUSA Cat. n° 80-5025-00) dans le surnageant de culture de
cellules T n'a pas détecté de sécrétion d'IL-5, comme le
montrent les figures 17 et 18. Comme IL-5 est typiquement
sécrété par des cellules T CD4+ amorcées, du phénotype TH2, la
5 stimulation combinée des cellules T par 1'hétérominibody
M79scFvCK/CD80CHl et 1'anticorps bispécifique simple chaîne
M79scFv-antiCD3scFv a prouvé qu'elle n'induit pas du tout
d'amorçage de cellules T TH2.
Exemple 5.7 : Analyse ELISA d'IL-4 dans un surnageant de culture
10 cellulaire de cellules T CD4+ stimulées
Comme dans l'analyse d'IL-5 décrite dans l'exemple 5.6, des
surnageants de culture de cellules T ont été analysés par test
ELISA (Pharmingen, Cat. n° 2629KI) pour détecter la présence
d' IL-4 une autre cytokine sécrétée typiquement par les cellules
15 T CD4+ amorcées du phénotype TH2. Comme aucun IL-4 n'a été
détecté, la stimulation de cellules T naïves CD4+ par
1'hétérominibody M79scFvCK/CD80CHl et 1'anticorps bispécifique
simple chaîne M79scFv-antiCD3scFv a confirmé qu'elle n'induit
pas d'amorçage de cellules TH2.
20 Exemple 6 : Co-stimulation de cellules T CD8+CD45RO- naïves par
1'hétérominibody M79scFvCK/CD80CHl
Exemple 6.1 : Purification de cellules T CD8+CD45RO- provenant
de sang périphérique de donneurs humains sains
Pour analyser la fonction biologique de 1'hétérominibody
25 M79scFv-CK/CD80-CHl, une expérience de stimulation de cellules T
CD8+ a été réalisée. Les cellules T CD8+CD4 5RO-, communément
considérées comme naïves, ont été isolées de sang périphérique
de donneurs sains, par sélection négative. Tout d'abord, les
cellules mononucléaires du sang périphérique ont été isolées par
30 gradient de densité Ficoll (Current Protocols of Immunology,
Coligan, Kruisbeek, Margulies, Shevach et Strober, Wiley-
Interscience, 1992). Après lavage des cellules trois fois par
solution saline tamponnée par phosphate supplémentée par 2 % de
sérum f?tal de veau, les cellules T CD8+ ont été purifiées au
35 moyen de colonnes du commerce pour cellules T CD8+ (R&D Systems,79
Minneapolis MN USA, Cat. n° HCD8C-1000). En plus du protocole du
fabricant, 1 ug/ml d'anticorps murin anti CDllb humaine a été
ajouté au cocktail d'anticorps fourni, afin d'éliminer les
cellules T suppresseurs qui sont CDllb+/CD28-. Au stade suivant,
5 les cellules T CD4 5RO+ ont été retirées par Dynabeads M450
paramagnétiques (Dynal, Hambourg, Cat. n° 110.02). A cet effet,
des cellules T CD8+ ont été incubées pendant 30 minutes avec
l'anticorps murin anti CD45RO humaine (UHCL-1) à une
concentration de 10 ug/ml. Ensuite, les cellules ont été lavées
10 deux fois, puis incubées encore pendant 30 minutes avec des
perles magnétiques conjuguées avec 1'anticorps M450 de mouton
anti IgGl de souris. Les cellules T CD8+CD45RO+ qui étaient
quantitativement attachées aux perles magnétiques ont été
retirées par application d'un aimant. Les cellules restantes
15 étaient CD8+CD45RO-CD28+ à une pureté de 95-98 %.
Exemple 6.2 : Stimulation de cellules T CD8+CD45RO- naïves par
incubation simultanée avec 1'hétérominibody M79scFvCK/CD80CHl
et/ou l'anticorps bispécifique simple chaîne M79scFv-antiCD3scFv
Les cellules CD8+CD45RO- ont été stimulées comme décrit dans
20 1'exemple 5 en utilisant les concentrations indiquées par le
tableau 3.
Le test de prolifération de BrdU ainsi que 1 ' analyse FACS ont
été effectués comme décrit dans 1'exemple 5. Les résultats sont
indiqués par les figures 19, 20, 21 et 34.
25 Exemple 6.3 : Analyse par test ELISA de TNF-a dans le surnageant
de culture cellulaire de cellules T CD8 stimulées
Afin de confirmer l'amorçage in vitro de cellules T CD8+ par la
combinaison de 1'hétérominibody et de l'anticorps bispécifique,
la concentration de TNF-a dans le surnageant de culture de
30 cellules T a été déterminée au moyen d'un test ELISA semi-
quantitafif de TNF-a (Genzyme DuoSet, Genzyme Diagnostics
Cambridge, MA USA Cat. n° 80-3932-00) réalisé selon le manuel du
fabricant. Comme TNF-a est sécrété typiquement par des cellules
T CD8+ amorcées, mais non naïves, les résultats indiqués par la80
figure 22 démontrent que l'amorçage des cellules T s'est produit
en présence de l'hétérominibody et de l'anticorps bispécifique,
mais non avec l'anticorps bispécifique seul.
Exemple 6.4 : Activité cytotoxique de lymphocytes T CD8+ amorcés
5 in vitro
Durant le processus d'amorçage, les cellules T CD8+ initialement
naïves acquièrent habituellement la capacité d'assurer la
médiation de la cytotoxicité des cellules cibles d'une manière
indépendante de CD80 (B7-1). L'indépendance par rapport à CD80
10 (B7-1) constitue ainsi un excellent marqueur biologique des
cellules T amorcées. Par conséquent, des cellules T CD8+CDllb"
CD4 5RO~ initialement naïves, qui avaient été amorcées pendant 6
jours comme décrit dans l'exemple 6.2, ont été utilisées comme
cellules effectrices dans un test de libération de 51Cr ; la
15 cytotoxicité des cellules T a été redirigée contre des cellules
Kato positives pour 17-lA par l'anticorps bispécifique simple
chaîne M79scFv-antiCD3scFv. Comme le montre la figure 35, les
cellules T CD8+ amorcées in vitro se sont révélées hautement
cytotoxiques contre les cellules Kato durant un test de
20 libération de 51Cr de 20 heures, en dépassant même 1 ' activité
cytotoxique des cellules mononucléaires de sang périphérique
fraîches. Au contraire, les cellules T CD8+ naïves n'ont pas
présenté d'effets cytotoxiques significatifs. Comme prévu, en
raison de l'indépendance par rapport à CD80 (B7-1), les cellules
25 T CD8+ amorcées in vitro n'ont pas présenté de cytotoxicité
redirigée accrue en présence de l'hétérominibody
M79scFVCK/CD80CHl. Ainsi, l'amorçage de cellules T CD8+ naïves
grâce à 1'hétérominibody M79scFvCK/CD80CHl en combinaison avec
un signal primaire approprié a pu être clairement démontré par
30 un troisième paramètre, en plus du changement de phénotype de
CD45RA/RO et de la sécrétion de cytokine. Le test de libération
de 51Cr a été effectué comme décrit par Mack, Proc. Natl. Acad.
Sei. USA 92 (1995), 7021-7025.
Exemple 7 : Hétérominibody M79scFvCKantiCD3scFv/CD80CHl81
Une autre version de 1'hétérominibody CD80 représentée par la
figure 23 a été construite en ajoutant un fragment antiCD3scFv,
par 1'intermédiaire d'un fragment de liaison glycine^sérinei à
1'extrémité C-terminale de la chaîne polypeptidique M79scFvCK
5 décrite dans l'exemple 1. A cet effet, le fragment d'ADN codant
pour cette chaîne polypeptidique a été excisé à partir du
plasmide d'expression pEF-DHFR- M79scFv-CK décrit dans l'exemple
1 et sous-cloné dans le vecteur pMa (Stanssens, Nucleic Acids
Res. 17 (1998) 441-4454) en utilisant les enzymes de restriction
10 EcoRI et Sali (Boehringer, Mannheim). Le fragment antiCD3scFv, a
été amplifié par PCR à partir de la matrice d'ADN codant pour
1'anticorps bispécifique simple chaîne M79scFv-antiCD3scFv
décrit par Mack, Proc. Natl. Sei. USA 92 (1995), 7021-7025, en
utilisant les amorces suivantes. L'amorce 5' VHTR66CKSAC (5'-CCT
15 GAG CTC GCC CGT CAC AAA GAG CTT CAA CAG GGG AGA GTG TGG AGG TGG
TGG ATC GGA TAT C-3') a introduit un site Sacl et l'amorce 3'
VLTR66SalNotXba a introduit les sites de clivage Sali, Notl et
Xbal (5'-ATT CTA GAG CGG CCG CGT CGA CTA TTT CAG CTC CAG CTT GGT
CCC AGC -3 ' ) . Le fragment obtenu par réaction en chaîne par
20 polymerase a été clone selon des procédures standard (Sambrook,
Molecular Cloning ; A Laboratory Manual, 2nd Edition, Cold Spring
Harbour Laboratory Press, Cold Spring Harbour, New York (1989))
dans le vecteur pMa, en utilisant les sites de clivage Sacl et
Xbal avec enzymes de restriction (Boehringer, Mannheim). Au
25 stade final, tout le fragment M79scFvCKantiCD3scFv représenté
par la figure 32 a été excisé à partir du vecteur pMa par les
enzymes de restriction EcoRI et Sali et sous-cloné dans le
vecteur d'expression eucaryotique pEF-DHFR décrit par Mack,
Proc. Natl. Acad. Sei. 92 (1995), 7021-7025. Le plasmide
30 d'expression obtenu a été transfecté dans des cellules CHO
déficientes en dihydrofolate reductase, avant transfection avec
le plasmide d'expression pEF-ADA-CD80-CHl décrit dans l'exemple
1. La double transfection et la sélection des cellules CHO ainsi
que la production et la purification de 1'hétérominibody ont été
35 réalisées comme décrit dans l'exemple 1.82
Pour démontrer la liaison de 1'hétérominibody
M79scFvCKantiCD3scFv/CD80CHl à l'antigène 17-lA et pour
confirmer la présence de CD80 correctement replié ainsi que la
structure hétérodimérique de 1'hétérominibody, un test ELISA a
5 été réalisé avec des surnageants de culture cellulaire après
sélection primaire et après le premier stade d'amplification du
gène ; 1'antigène 17-lA recombinant a été immobilisé et
1 'hétérominibody lié a été détecté au moyen d'un anticorps anti
CD80, comme décrit dans 1'exemple 1.2.3. Les résultats sont
10 indiqués par la fig. 40.
L'augmentation du niveau d'expression due à 1'amplification du
gène a également été contrôlée par test ELISA ; dans ce but,
1'antigène 17-lA recombinant a été immobilisé, incubé avec du
surnageant de culture contenant 1'hétérominibody
15 M79scFvCKantiCD3scFv/CD80CHl et 1'hétérominibody lié a été
détecté au moyen d'un anticorps anti étiquette histidine
conjugué avec de la peroxydase (Roche, Cat. n° 1965085) , dilué
au 1/500. Les résultats sont indiqués par la fig. 41. La
procédure générale ELISA a été exécutée comme décrit dans
20 1'exemple 4.4.
L'interaction du fragment scFv, situé sur l'extrémité C-
terminale, et de CD3 sur des cellules T humaines a été confirmée
par cytométrie de flux. A cet effet, des cellules T CD8+,
positives pour CDllb, ont été isolées, parce que ce sous-
25 ensemble de cellules T est connu pour être négatif pour CD28.
L'isolement des cellules T CD8+, positives pour CDllb, a été
réalisé au moyen de colonnes du commerce pour cellules T CD8+,
comme décrit dans 1'exemple 6.1, sauf qu'aucun anticorps de
CDllb n'a été ajouté au cocktail d'anticorps du fabricant. Au
30 stade suivant, des cellules T positives pour CDllb ont été
positivement sélectionnées au moyen de Dynabeads M450
paramagnétiques (Dynal, Hambourg, Cat. n° 110.02) ; à cet effet,
des cellules T CD8+ ont été incubées pendant 30 minutes avec un
anticorps murin anti CDllb humaine à une concentration de 10
35 (ig/ml. Ensuite, les cellules ont été lavées deux fois, puis83
incubées encore pendant 30 minutes avec des perles magnétiques
conjuguées avec un anticorps de mouton anti IgGl de souris. Les
cellules T CD8+ positives pour CDllb attachées aux perles
magnétiques ont été isolées par application d'un aimant et la
5 cytométrie de flux standard a confirmé qu'elles n'expriment ni
CD28 ni CTLA-4. Les cellules T CD8+ positives pour CDllb ont
ensuite incubé pendant 30 minutes sur de la glace avec
hétérominibody M79scFvCKantiCD3scFv/CD80CHl purifié, à
différentes concentrations. Après lavage dans une solution
10 saline tamponnée par phosphate, les cellules ont été incubées
avec un anticorps anti Ckappa humaine conjugué avec isothiocyanate
de fluorescéine (Coulter Cat. n° 660287)-, dilué à 1/10, lavées
à nouveau dans une solution saline tamponnée par phosphate, puis
soumises à la cytométrie en flux. Les résultats indiqués par la
15 fig. 42 démontrent clairement la liaison de 1'hétérominibody au
CD3 humain sur les cellules T, puisque les deux contre-
récepteurs de CD80 sont absents de ce sous-ensemble particulier
de cellules T utilisé dans cette expérience. De plus, les
résultats fournissent 1'exemple de la fonctionnalité d'un
20 polypeptide ayant une fonction de récepteur ou de ligand,
lorsqu'il est situé en position C-terminale à 1'intérieur d'un
hétérominibody.
Un second dérivé antiCD3scFv de 1'hétérominibody
M79scFvCK/CD80CHl a été obtenu en introduisant un fragment
25 d'ADN, obtenu par réaction en chaîne par polymerase, codant pour
le fragment anti-CD3scFv de 1'anticorps bispécifique simple
chaîne (bscAb) M79scFv-antiCD3scFv décrit par Mack, Proc. Natl.
Acad. Sei. USA 92 (1995), 7021-7025, dans le site de restriction
BspEl du plasmide d'expression pEF-DHFR-M79scFv-CK (voir exemple
30 1.2.1). Le fragment antiCD3scFv a été amplifié par PCR à partir
de la matrice d'ADN codant pour bscAbM79scFv-antiCD3scFv en
utilisant l'amorce 5' VHTR66BspEl (5'-GTC ACC GTC TCC TCC GGA G-
3') et l'amorce 3' VLTR66BspEl (5'-GTG TCC GGA TTT CAG CTC CAG
CTT GGT CC-3') et digéré avec BspEl avant clonage dans pEF-DHFR-
35 M79scFv-CK. L'orientation correcte du fragment clone a été84
vérifiée par réaction en chaîne par polymerase, en utilisant les
amorces 5 ' VHTR66BspEl ( 5 ' -GTC ACC GTC TCC TCC GGA G3 ' ) en
hybridant immédiatement en amont de la séquence ADN M79scFv à
1'intérieur du vecteur d'expression pEF-DHFR et de la séquence
5 charnière 3' (5'-GGT GTG GGT GGT GTC ACC-3 ' ) . Le plasmide
d'expression obtenu pEF-DHFR-bscAbM79scFv-antiCD3scFv-CK (voir
figure 44) a été transfecté avec le plasmide d'expression pEF-
ADA-CD80-CH1 dans des cellules CHO, comme décrit dans l'exemple
1.2.1. Il faut noter que, dans ce cas, le polypeptide ayant une
10 fonction de récepteur ou de ligand, fusionné à l'extrémité N-
terminale du domaine Ckappa de l'hétérominibody obtenu (voir fig.
43) est identique à 1'anticorps bispécifique simple chaîne
M79scFv-antiCD3scFv (Mack, Proc. Natl. Acad. Sei. USA 92 (1995),
7021-7025). L'amplification du gène ainsi que la production et
15 la purification de 1'hétérominibody ont été réalisées comme
décrit dans l'exemple 1.2.2.
Afin de confirmer le repliement correct du bras CK de
1'hétérominibody bscAbM79scFv-antiCD3scFv-CK/CD80-CHl ainsi que
la structure hétérodimérique de la molécule recombinante, la
20 liaison à 1'antigène 17-lA immobilisé a été démontrée par un
test ELISA réalisé avec des surnageants de culture cellulaire
après sélection primaire et après le premier stade
d'amplification du gène. L'hétérominibody lié a été détecté au
moyen d'un anticorps anti étiquette histidine, conjugué à de la
25 peroxydase (Roche, Cat n°1965085), dilué au 1/500. Les résultats
sont indiqués par la fig. 45. La procédure générale du test
ELISA a été effectuée comme décrit dans l'exemple 4.4.
Afin de confirmer la présence de CD80 correctement replié à
1'intérieur de 1'hétérominibody bscAbM79scFv-antiCD3scFv-
30 CK/CD80-CH1, le test ELISA suivant a été réalisé avec
surnageants de culture cellulaire après sélection primaire et
après le premier stade d'amplification du gène :
Un anticorps monoclonal anti CD80 humain (Immunotech, Cat. n°
1449), dilué à 1/200, a été immobilisé sur une plaque ELISA,
35 avec ensuite incubation avec des surnageants de culturecellulaire. Ensuite, 1'hétérominibody capturé par 1'anticorps
anti CD80 a été détecté au moyen d'un anticorps anti étiquette
histidine, conjugué à de la peroxydase (Roche, Cat n°1965085),
dilué au 1/500. Les résultats sont indiqués sur la fig. 46. La
5 procédure générale du test ELISA a été effectuée comme décrit
dans 1'exemple 4.4.
En résumé, ces résultats montrent que la forme d'hétérominibody
peut aussi porter des polypeptides ayant des structures de
protéines plus complexes et/ou une fonction de récepteur ou de
10 ligand plus complexe, comme par exemple les anticorps
bispécifiques simple chaîne.
Exemple 8 : structures CD80-M79scFv
8.1 Structure CD80-M79scFv (VX/VH) avec fragment de liaison
(Gly^Seri)! court
15 Une protéine qui est constituée par le fragment Fv simple chaîne
(scFV) de l'anticorps M79 de souris anti 17-lA et par la partie
extracellulaire de la protéine CD80(B7-1) co-stimulatrice,
reliée par un fragment de liaison (Gly4Seriîi (figure 24) a été
construite. L'anticorps M79 a été obtenu comme décrit par
20 GÔttlinger et coll. (1986), Int. J. Cancer 38, 47-53. Le
fragment M79 scFv a été clone comme décrit par Mack et coli.,
Proc. Natl. Acad. Sei. 92 (1995), 7021-7025. Le plasmide complet
a été clone en plusieurs étapes. Tout d'abord un poly-fragment
de liaison désigné par CTI a été introduit dans le vecteur
25 Bluescript KS (numéro d'accès X52327 à GenBank®) en utilisant
les sites de clivage par enzymes de restriction Xbal et Sali
(Boehringer Mannheim). L'introduction du poly-fragment de
liaison CTI a fourni des sites de clivage supplémentaires ainsi
que la séquence codant pour le fragment de liaison (Gly^Ser^ if
30 une étiquette histidine à six acides aminés et un codon d'arrêt,
comme indiqué sur la figure 2. Le vecteur Bluescript KS CTI a
été préparé par clivage avec les enzymes de restriction EcoRV et
Xmal (Boehringer Mannheim et New England Biolabs) afin de le
lier (T4 DNA, Ligase Boehringer Mannheim) avec le fragment M79
35 scFv clivé par EcoRV et BspEl. Le vecteur obtenu Bluescript KS-86
CTI+M79 scFv a été à nouveau clivé avec EcoRI (Boehringer
Mannheim) et BspEl afin d'introduire le fragment d'ADN de CD80,
préalablement préparé au moyen des mêmes enzymes. Avant le sous-
clonage, le fragment de CD80 a été obtenu par réaction en chaîne
5 par polymerase en utilisant des amorces spécifiques
d'oligonucleotides complémentaires aux extrémités 5 ' et 3 ' de la
séquence nucléotidique codant pour la partie extracellulaire de
CD80 (Freeman G.J. et coll. J. Immunol. 143, (1989) 2714-2722).
Ces amorces ont également introduit un site de clivage EcoRI et
10 un BspEl (amorce 5'CD80 : 5' GCA GAA TTC ACC ATG GGC CAC ACA CGG
AGG CAG 3' ; amorce 3'CD80 : 5 ' TGG TCC GGA GTT ATC AGG AAA ATG
CTC TTG CTT G 3 ' ) . La matrice d'ADNc pour cette réaction en
chaîne par polymerase a été préparé par transcription inverse de
1 'ARN total préparé à partir de la ligne Raj i de cellules du
15 lymphome de Burkitt selon des procédures standard. (Sambrook,
Molecular Cloning ; A Laboratory Manual, 2nd Edition, Cold Spring
Harbour Laboratory Press, Cold Spring Harbour, New York (1989)).
La protéine co-stimulatrice de CD80 appartient à la superfamille
d' Ig. C'est une protéine lourdement glycosylée de 262 acides
20 aminés. Une description plus détaillée a été publiée par Freeman
G.J. et coll. J. Immunol. 143, (1989) 2714-2722).
Au stade final, tout le fragment CD80-M79scFv (VL/VH) d'ADN
(figure 25) a été isolé par clivage du vecteur Bluescript
KS+CTI+CD80+M79scFv (VL/VH) avec Ecorl et Sali (Boehringer
25 Mannheim), puis introduit dans le vecteur d'expression eucaryote
pEF-DHFR, décrit par Mack et coll., Proc. Natl. Sei. USA 92
(1995), 7021-7025., contenant le gène dihydrofolate reductase
comme marqueur de sélection. Le plasmide final a été linéarisé
avec 1'enzyme de restriction Ndel (Boehringer Mannheim) et
30 transfecté dans des cellules CHO par électroporation. Les
conditions d'électroporation étaient 260 V/960 uF, par
utilisation d'un BioRad Gene Pulser?. Une expression stable a
été effectuée dans des cellules CHO déficientes en dihydrofolate
reductase, comme décrit par Kaufmann R.j. et coll. (1997)
35 Methods Enzymol. 185, 537-566. Les cellules ont été cultivées87
pour sélection dans un milieu a-MEM sans nucleoside, supplémenté
par 10 % de sérum f?tal de veau dialyse, 2 mM de L-glutamine.
Pour la production de la construction bifonctionnelle CD80-M79
scFv (VL/VH) , les cellules ont été cultivées dans des flacons à
5 bille (Falcon) pendant 7 jours dans 300 ml de milieu de culture.
La protéine a été purifiée par 1 ' intermédiaire de son étiquette
histidine attachée à l'extrémité C-terminale (voir figure 24) en
utilisant une colonne Ni-NTA (Mack et coli., Proc. Natl. Acad.
Sei. 92 (1995), 7021-7025). Différents tests ELISA ont été
10 effectués pour analyser les propriétés de liaison :
8.1.1 Test ELISA avec surnageant de culture cellulaire utilisant
la détection anti étiquette histidine
La liaison à l'antigène 17-lA a été analysée au moyen de
15 1'antigène 17-lA soluble, obtenu comme décrit (Mack et coli.
Proc. Natl. Acad. Sei. 92 (1995), 7021-7025) par expression
stable, dans des cellules CHO, de l'ADN codant pour les 264
premiers acides aminés de l'antigène 17-lA, connu également sous
le nom de GA 733-2 (Scala, Proc. Natl. Acad. Sei. 87 (1990),
20 3542-3546), suivis d'un codon d'arrêt. L'antigène a été
immobilisé sur des plaques ELISA 96 puits à fond en U (Nunc
maxisorb) à une concentration de 50 ug/ml de solution saline
tamponnée par phosphate. Le recouvrement a été réalisé à 4 °C
pendant 12 heures avec 50 ul, suivi par lavage une fois avec la
25 solution saline tamponnée par phosphate Tween à 0,05 %. Le test
ELISA a été bloqué ensuite pendant 1 heure avec une solution
saline tamponnée par phosphate contenant 3 % de sérum-albumine
bovine et lavé à nouveau une fois. Ensuite, le surnageant de
culture cellulaire a été ajouté non dilué et à plusieurs
30 dilutions, et incubé pendant 2 heures. Comme système de
détection, un anticorps anti IgGl de souris anti étiquette
histidine (Dianova, Hambourg) dilué au 1/200 et un anticorps
polyclonal de chèvre anti IgG de souris (spécifique Fc) conjugué
à de la peroxydase (Dianova Hambourg) ont été appliqués
35 séquentiellement. Le test ELISA a été développé en ajoutant lasolution de substrat ABTS (2'2 azino-bis (3-éthylbenzthiazoline-
6 acide sulfonique), SIGMA A-1888, Steinheim), comme décrit dans
l'exemple 2.1. Le résultat a été mesuré par un lecteur ELISA à
une DO de 405 nm ; les résultats sont indiqués sur la figure 26.
5 Evidemment, aucune activité de liaison n'a pu être mesurée.
Comme contrôles négatifs, les plaques ont été incubées avec la
solution saline tamponnée par phosphate au lieu des structures
d'anticorps. Le contrôle positif a été effectué avec 1'anticorps
bispécifique simple chaîne anti 17-lA/anti CD3, décrit
10 précédemment (Mack et coll., Proc. Natl. Acad. Sei. 92 (1995),
7021-7025).
8.1.2 Test ELISA avec surnageant de culture cellulaire utilisant
la détection anti-CD80
15 L'immobilisation de l'antigène 17-lA, le blocage et 1'incubation
de surnageants de culture cellulaire ont été effectués comme
décrit précédemment. La détection a été effectuée par un
anticorps anti IgGl de souris anti-CD80 dilué au 1/1000
(Dianova, Hambourg), suivi par un anticorps polyclonal de chèvre
20 anti IgG de souris (Fc) conjugué à de la peroxydase dilué au
1/5000 (Dianova, Hambourg). Le test ELISA a été développé avec
la solution de substrat ABTS et les valeurs de la DO ont été
mesurées comme décrit précédemment ; cependant, aucune activité
de liaison de 17-lA n'a pu à nouveau être détectée. Pour le
25 contrôle positif, 1'anticorps bispécifique simple chaîne anti
17-lA/anti CD3 (Mack et coll., Proc. Natl. Acad. Sei. 92 (1995),
7021-7025) a été utilisé et détecté par l'anticorps anti
étiquette histidine décrit. Les résultats sont indiqués sur la
figure 27.
30 8.1.3 : Analyse par test ELISA de la construction CD 80-M79scFv
recombinante purifiée
Comme les tests ELISA avec surnageants de culture cellulaire
détectant des liaisons à un antigène spécifique étaient tous
négatifs, un CD80-M79scFv soluble a été obtenu par purification
35 de protéine à partir du surnageant d'une culture en flacon à89
bille (300 ml) afin d'exclure la possibilité qu'aucune protéine
recombinante n'ait été sécrétée dans le surnageant. La
purification a été réalisée au moyen d'une colonne de nickel-NTA
(Mack, M. et coll., Proc. Natl. Sei. USA 92 (1995), 7021-7025).
5 Les puits du test ELISA ont été recouverts de la protéine éluée
à partir de la colonne de nickel-NTA. La détection de la
construction bifonctionnelle CD80-M79scFv a été effectuée
indépendamment de son activité de liaison à 1'antigène 17-lA en
utilisant soit un anticorps anti étiquette histidine (voir
10 exemple 8.1.1) soit un anticorps anti-CD80 (voir exemple 8.1.2)
au cours d'expériences distinctes, suivis respectivement par un
anticorps anti IgG de souris (FC) . Le développement du test
ELISA ainsi que la mesure des valeurs de la densité optique ont
été effectués comme décrit précédemment. Les résultats sont
15 indiqués sur la figure 28, confirmant la présence de la
construction CD80-M79scFv dans le surnageant de culture
cellulaire.
8.2 Construction CD80-M79scFv (VH/VL) avec le fragment de
liaison (Gly^Seri) !
20 Pour modifier 1'arrangement des régions variables d ' Ig à
l'intérieur du fragment M79scFv de VL/VH à VH/VL, une réaction
en chaîne par polymerase en deux phases, pour fusion, utilisant
les amorces d'oligonucléotides 5'VHB5RRV : AGG TGT ACA CTC CGA
TAT C(A,C)A (A,G)CT GCA G(G,C)A GTC (A;T)GG, 3'VHGS15 : 5 ' GGA
25 GCC GCC GCC GCC AGA ACC ACC ACC ACC TGA GGA GAC GGT GAC CGT GGT
CCC TTG GCC CCA G 3', 5'VLGS15 : 5 ' GGC GGC GGC GCC TCC GGT GGT
GGT GGT TCT GAC ATT CAG CTG ACC CAG TCT CCA3 ' et 3'VLBspEl :
5'AAT CCG GAT TTG ATC TCG AGC TTG GTC CC3', a été réalisée selon
la procédure décrite par Mack et coli., Proc. Natl. Acad. Sei.
30 92 (1995), 7021-7025 (voir également exemple 2.1). Le fragment
PCR, codant pour le fragment VH/VL-scFv a été clivé par les
enzymes de restriction EcoRV/BspEl et introduit dans le vecteur
Bluescript KS + CTI déjà préparé par clivage avec EcoRV/Xmal
(voir exemple 8.1). Ensuite, le fragment M79scFv (VH/VL) inversé
35 a été excisé au moyen des enzymes de restriction BspEl/Sali et90
introduit dans le plasmide pEF-DHFR-CTI + CD80-M79scFv (VL/VH)
en utilisant BspEl/Sall, en remplaçant ainsi le fragment
M7 9scFv-VL/VH (voir figure 25) . Les procédures de transfection
et de culture cellulaire ont été réalisées comme décrit
5 précédemment. L'analyse de liaison à 1 'antigène a été effectuée
par le test ELISA 17-lA décrit (exemple 8.1.2) . Cependant,
aucune activité de liaison de la construction modifiée CD80-
M79scFv n'a pu être détectée. Les résultats sont indiqués sur la
fig. 29.
10 8.3 Construction CD80-M79scFv (VH/VL) comprenant le fragment de
liaison (Gly4Seri)3 long
Tout d'abord, le fragment M7 9scFv (VH/VL) a été obtenu par une
PCR en deux phases, pour fusion, telle que décrite dans
1'exemple 8.2. Le fragment PCR obtenu, codant pour le fragment
15 VH/VL-scFv a été clivé par les enzymes de restriction
EcoRV/BspEl et sous-cloné dans le vecteur Bluescript KS + CTI
clivé avec EcoRV/Xmal (voir exemple 8.1) . A un stade suivant, un
fragment de liaison glycine-sérine plus long ( Gly,, Ser i) 3 composé
de 15 acides aminés a été introduit. A cet effet, un autre
20 fragment de liaison d'oligonucléotides (ACCGS15BAM) qui a été
conçu pour coder le fragment de liaison (Gly^Serx) 3 et pour
fournir des dépassements compatibles avec BspEl et BamHI, a dû
être introduit dans le vecteur Bluescript KS + CTI + M79 scFv
(VH/VL) (exemple 8.2). La séquence nucléotidique du fragment de
25 liaison est indiquée sur la fig. 30.
Le plasmide Bluescript KS + CTI + M79 scFv (VH/VL) incluant la
séquence codante pour le fragment de liaison (Gly «Ser 3) 3 a été
clivé avec BspEl et Sali et le fragment d'ADN obtenu (Gly4Ser1}3+
M79scFv (VH/VL) a été introduit dans le vecteur pEF-DHFR, clivé
30 par BspEl/Sall, contenant le fragment codant CD80 (exemple 8.1),
remplaçant ainsi le fragment M7 9scFv (VL/VH) ainsi que le
fragment de liaison (Gly4Seri)i court (voir fig. 25). La
procédure de transfection et de culture cellulaire est celle de
1'exemple 8.1. La liaison spécifique à 1'antigène a été analysée
35 par test ELISA de 17-lA, comme décrit précédemment (exemple91
8.1.1) et la détection de la protéine recombinante fonctionnelle
dans le surnageant de culture cellulaire a été effectuée avec un
anticorps anti étiquette histidine, suivi par un anticorps anti
IgG (Fc) de souris (comparer exemple 8.1.1). L'anticorps
5 bispécifique simple chaîne anti-17-lA/anti-CD3 (Mack et coli.,
Proc. Natl. Acad. Sei. 92 (1995), 7021-7025) a servi de contrôle
positif. Le développement du test ELISA et la mesure des valeurs
de DO ont été effectués comme décrit précédemment (exemple
8.1.1). Cependant, aucune liaison à 1'antigène n'était
10 détectable. Les résultats sont indiqués sur la fig. 31.
Exemple 9 : Résultats imprévisibles de l'expression, dans des
cellules hôtes de mammifère, de protéines recombinantes portant
les domaines d'oligomérisation établis dans E. coli
Afin de déterminer si la faisabilité des stratégies
15 d'oligomérisation des polypeptides dans des cellules hôtes de
mammifère peut être prévue par leur application réussie dans E.
coli, deux différents domaines d'oligomérisation, caractérisés
par des systèmes d'expression bactériens ont été testés dans des
protéines de fusion, exprimées par des cellules de mammifère
20 (Pack (1993) Biotechnology 11 : 1271 ; Rheinnecker (1996) J.
Immunol. 157 : 2989) . La première protéine de fusion qui a été
testée est composée de deux domaines fonctionnels, le fragment
M79scFv spécifique à 17-lA sur 1'extrémité N-terminale et 1'IL-2
humaine sur 1'extrémité C-terminale ; entre ces deux domaines
25 fonctionnels, on a introduit un domaine de dimérisation ou de
tétramérisation, ce qui donne les chaînes polypeptidiques
représentées par les figures 47 et 4 8 respectivement. Les
fragments d'ADN correspondants ont été clones dans le vecteur
d'expression pEF-DHFR avec les enzymes de restriction EcoRI et
30 Sali et transfectés dans des cellules CHO déficientes en
dihydrofolate reductase, comme décrit (Mack, Proc. Natl. Acad.
Sei. USA 92 (1995) , 7021-7025) (il faut noter que les deux
séquences d'ADN représentées sur les figures 47 et 48 portent un
site interne de reconnaissance de EcoRI, exigeant ainsi une
35 digestion partielle avec cette enzyme de restriction). Les92
surnageants de culture des cellules CHO transfectées ainsi que
les lysats cellulaires correspondants, préparés selon des
procédures standard, ont été soumis au test ELISA. L'antigène
17-lA recombinant immobilisé a été incubé avec du surnageant de
5 culture ou du lysat cellulaire et la structure liée a été
détectée par un anticorps anti étiquette histidine conjugué avec
de la peroxydase (Roche, Cat. n° 1965085) dilué à 1/500. La
procédure générale ELISA a été effectuée telle que décrite dans
1 ' exemple 4.4. Les résultats indiqués par la fig. 50 démontrent
10 que seule la structure tétramérique, et non la structure
dimérique, est trouvée dans le surnageant et donc produite sous
forme de protéine pouvant être sécrétée et totalement
fonctionnelle dans des cellules de mammifère, bien que ces deux
structures soient bien détectables dans le lysat cellulaire. En
15 conclusion, le domaine de dimérisation a révélé qu'il n'est pas
applicable d'une manière générale pour les stratégies
d'oligomérisation dans les cellules hôtes de mammifère.
Afin de tester encore le domaine prometteur de tétramérisation,
il a été introduit dans une autre protéine de fusion qui
20 ressemble étroitement à la construction M79scFv-IL-2. Ce
polypeptide est composé du fragment DC8scFv (Schäkel, Eur. J.
Immunol. 28 (1998), 4084-4093) sur l'extrémité N-terminale et du
domaine extracellulaire de erbB2 humain sur 1'extrémité C-
terminale (il faut noter que le domaine extracellulaire de erbB2
25 humain est sécrété aussi par des cellules de mammifère sous la
forme de IL-2 humaine). La chaîne polypeptidique complète est
représentée par la fig. 49. Le fragment d'ADN correspondant a
été également clone dans le vecteur d'expression pEF-DHFR avec
les enzymes de restriction EcoRI et Sali et transfecté dans des
30 cellules CHO déficientes en dihydrofolate reductase, comme
décrit (Mack, Proc. Natl. Acad. Sei. USA 92 (1995), 7021-7025).
Le surnageant de culture des cellules CHO transfectées ainsi que
le lysat cellulaire correspondant, préparé selon des procédures
standard, ont été testés par un test ELISA en sandwich
35 spécifique de erbB2, basé sur deux anticorps anti-erbB2 (7C193
chimère et Her81 de souris) qui reconnaissent différents
epitopes permettant la liaison simultanée à 1'antigène. Le 7C1
chimérique, immobilisé sur une plaque ELISA, a été incubé avec
plusieurs dilutions de surnageant de culture ou lysat
5 cellulaire, en capturant ainsi la construction tétramerique
DC8scFv-erbB2Ec/ laquelle a pu être ensuite détectée par le Her81
de souris, suivi par un anticorps polyclonal de chèvre anti IgG
de souris, spécifique Fc, conjugué à de la peroxydase (Dianova,
Hambourg, Cat. n' 115-035-071), dilué au 1/5000. Comme contrôle
10 positif, des dilutions équivalentes de surnageant de culture et
de lysat cellulaire de la construction tétramerique M79scFv-IL-2
ont été analysées parallèlement au test ELISA décrit
précédemment ; les résultats sont indiqués sur la fig. 51A. La
procédure générale ELISA a été effectuée telle que décrite dans
15 1'exemple 4.4.
Les résultats indiqués par la fig. 5 IB démontrent que,
contrairement à la construction tétramerique M7 9scFv-IL-2, la
construction tétramerique DC8scFv-erbB2EC, étroitement liée,
n'est pas détectable dans le surnageant et ne peut donc pas être
20 produite sous la forme de protéine pouvant être sécrétée et
totalement fonctionnelle dans des cellules hôtes de mammifère,
bien qu'elle soit indubitablement présente dans le lysat
cellulaire. En conclusion, le domaine de tétramérisation n'a pas
démontré non plus de possibilité d'application générale des
25 stratégies d'oligomérisation dans les cellules hôtes de
mammifère.
Bien que les deux domaines d'oligomérisation soient bien établis
pour 1'olgomérisation des polypeptides dans E. coli et soient
considérés, dans la littérature, comme adéquats pour les
30 protéines de fusion, telles que celle qui a été testée dans cet
exemple (Rheinnecker (1996), J. Immunol. 157 : 2989), il est
clair qu'ils n'ont pas, en règle générale, atteint ce but dans
les cellules hôtes de mammifère. Ainsi, il apparaît, comme
principe fondamental, que l'utilisation réussie des domaines
35 d'olgomérisation dans E. coli ne permet pas de prévoir leur94
possibilité d'application générale dans les cellules hôtes de
mammifère.
Exemple 10 Conception d'un hétérominibody avec domaines
effecteurs présents aux quatre positions
5 La forme de 1'hétérominibody permet principalement 1'addition de
quatre domaines effecteurs distincts aux deux positions à
1'extrémité N-terminale et deux positions à 1'extrémité C-
terminale présentes au c?ur des domaines CHi et Ckappa liés par
des ponts disulfure (voir figure 52) . Tandis que les exemples
10 précédents ont montré que les domaines effecteurs, tels que Fvs
simple chaîne (scFvs) et molécules co-stimulatrices, conservent
leur fonctionnalité sur les extrémités N-terminales de
1'hétérominibody, il n'est pas évident que deux domaines
effecteurs puissent être fonctionnellement liés en même temps
15 aux positions sur 1 'extrémité C-terminale de CH1 et Ck (kappa) .
Un repliement inadéquat, un obstacle stéréochimique par les
séquences sur l'extrémité N-terminale ou un obstacle réciproque
peuvent perturber 1'activité des domaines effecteurs liés aux
extrémités C-terminales des hétérominibodies ou empêcher
20 1'expression de ces hétérominibodies dans les cellules de
mammifère.
Afin de démontrer que, premièrement, les hétérominibodies
peuvent être réalisés avec les quatre positions liées à des
domaines effecteurs et, deuxièmement, que deux domaines ajoutés
25 en position C-terminale conservent leur activité biologique,
1'hétérominibody représenté sur la figure 53 a été conçu. Dans
cette molécule, une simple chaîne Fv ("HD7 0 scFv" correspondant
aux nucleotides 96 à 842 représentés dans l'une ou l'autre des
deux séquences de nucleotides indiquées sur les figures 55a et
30 55b. L'anticorps correspondant HD70, décrit dans le document WO
98/46645), est lié par son extrémité N-terminale au domaine Cm
humain qui porte sur son extrémité C-terminale le facteur de
stimulation des colonies de granulocytes/macrophages (GM-CSF)
constituant une cytokine dans les processus inflammatoires
35 humains, plus une séquence d'hexahistidine pour faciliter la95
purification. Pour la deuxième chaîne polypeptidique, le domaine
humain Ck a eu aussi un HD70 scFv lié à son extrémité N-
terminale, mais 1'interleukine-2 (IL-2), constituant une
cytokine dans les processus inflammatoires humains, est liée à
5 son extrémité C-terminale. Afin de fournir une liaison flexible,
un fragment de liaison sérine-glycine a été placé entre les
domaines CHi et Ck et les cytokines liées par les extrémités C-
terminales. Le HD70 scFv reconnaît spécifiquement la molécule
d'adhérence aux cellules epitheliales humaines (EpCAM, appelée
10 également antigène 17-lA).
Les vecteurs d'expression plasmidiques, codant pour les chaînes
HD70-CH1-GM-CSF et HD70-Ck-IL-2 ont été réalisés. Les vecteurs
d'expression de cellules de mammifère précédemment mentionnés
ont été utilisés (pEF-DHFR, pEF-ADA). L'arrangement des diverses
15 séquences d'ADN codant pour les domaines dans les deux vecteurs
d'expression est représenté sur la figure 54. Pour une sécrétion
adéquate dans des cellules de mammifère, une séquence codant
pour un peptide leader provenant d'IgG a été ajoutée aux
extrémités 5 ' des structures. Les séquences entières de
20 nucleotides et d'acides aminés des deux séquences codant pour
les HD70-CH1-GM-CSF et HD7 0-CK-IL-2 sont représentées sur la
figure 55.
Exemple 11 : Production et caractérisation d'un hétérominibody
anti-EpCAM avec deux cytokines distinctes liées à ses extrémités
25 C-terminales
Afin de tester si l'hétérominibody représenté sur la figure 53
est exprimé et sécrété, des cellules (CHO) d'ovaire de hamster
chinois ont été transfectées séquentiellement au moyen de
Superfect (Qiagen) avec des vecteurs codant pour les deux
30 chaînes de 1'hétérominibody et des cellules effectuant
1'expression de manière stable ont été sélectionnées comme
décrit précédemment. Les surnageants de culture cellulaire
provenant de cellules CHO transfectées de manière stable ont été
analysés par FACS pour déterminer la présence d'une activité de
35 liaison aux cellules CHO exprimant de manière stable la EpCAM96
humaine (voir exemples précédents). Pour détecter
l'hétérominibody se liant aux cellules CHO positives pour EpCAM,
un anticorps murin anti GM-CSF humain (Biosource, Cat. n° AHC
2812) a été utilisé. Le deuxième anticorps a été détecté par un
5 anticorps de mouton anti-souris, étiqueté par isothiocyanate de
fluorescéine (Sigma, Cat. n° F6257). Aucune liaison n'a été
observée avec le surnageant provenant de cellules CHO non
transfectées (tableau supérieur de la figure 56) . Des quantités
croissantes de surnageant provenant de cellules CHO transfectées
10 de manière stable ont provoqué un décalage croissant de la
valeur moyenne de la fluorescence vers la droite, indiquant une
quantité croissante d'hétérominibody se liant aux cellules CHO
positives pour EpCAM (figure 56, tableaux inférieurs). Ceci
montre qu'au moins une des chaînes a été exprimée et sécrétée,
15 tout en conservant un scFv fonctionnel spécifique de 1'EpCAM sur
son extrémité N-terminale.
Ensuite, on a recherché si 1'activité de 1'EpCAM dans le
surnageant de cellules CHO transfectées est physiquement liée à
1'immunoréactivité pour les cytokines GM-CSF et IL-2. Dans ce
20 but, un test ELISA qui capture les anti-EpCAM scFvs par leur
liaison aux domaines extracellulaires recombinants d'EpCAM
(Micromet) qui a été utilisé pour recouvrir les plaques ELISA a
été réalisé. Les molécules liées ont été testées ensuite par des
anticorps spécifiques pour détecter la présence
25 d'immunoréactivité pour 1'IL-2 humaine (Pharmingen Cat. n°
18951D + anticorps de chèvre anti rat, étiqueté par
isothiocyanate de fluorescéine (Sigma, Cat. n° F6258)) et le GM-
CSF humain (Biosource, Cat. n° AHC 2812 + anticorps de mouton
anti souris, étiqueté par isothiocyanate de fluorescéine (Sigma,
30 Cat. n° F6257)), respectivement. Comme le montre la figure 57
(colonnes 2) , 1'EpCAM lié a en effet capturé une activité qui
était fortement immunoréactive avec des anticorps pour IL-2 et
GM-CSF. Ces réactivités n'ont pas été observées dans le
surnageant de cellules CHO non transfectées (colonnes 1) . Ces
35 données montrent que les deux chaînes d'hétérominibody ont été97
exprimées et sécrétées et que les cytokines qui sont liées par
leur extrémité C-terminale aux chaînes d'hétérominibody
confirment ce qui peut être reconnu par leurs anticorps
respectifs.
5 Une caractéristique importante de la forme d'hétérominibody est
la liaison physique serrée des deux chaînes polypeptidiques.
Afin de rechercher si IL-2 et GM-CSF qui font partie de chaînes
polypeptidiques différentes (voir figure 53) sont réellement
liés physiquement dans un hétérominibody, on a établi un test
10 ELISA dans lequel les molécules contenues dans le surnageant de
culture de cellules CHO sont capturées, sur la plaque ELISA, par
un anticorps au GM-CSF humain (Biosource, voir précédemment) et
ensuite analysées avec un anticorps anti-IL-2 pour la réactivité
(Pharmingen, voir précédemment, et streptavidine conjuguée avec
15 de la phosphatase alcaline, DAKO Cat. n° D0396) . De même, la
capture a été effectuée avec un anticorps anti-IL-2 (voir
précédemment), suivi de la détection au moyen d'un anticorps
anti GM-CSF biotynilé (Biosource, Cat. n° AHC 2919), suivi par
de la streptavidine conjuguée avec de la phosphatase alcaline,
20 (DAKO Cat. n° D0396) . Les résultats indiqués sur la figure 58
(colonnes 2) démontrent qu'en fait les anticorps au GM-CSF ou de
1'IL-2 sont capables de précipiter les immunoréactivités de IL-2
ou GM-CSF, respectivement. Ceci montre que GM-CSF et IL-2
étaient l'un et l'autre étroitement associés à une molécule. Le
25 surnageant provenant de cellules CHO contrôles n ' a pas montré de
réactivités (figure 58, colonnes 1).
Une autre caractéristique importante de la forme
d'hétérominibody est la liaison covalente des deux chaînes par
un pont disulfure. Afin de démontrer que l'expression des deux
30 chaînes dans les cellules CHO a eu pour résultat une molécule
réunie par covalence, qui présente des réactivités pour IL-2 et
GM-CSF, 1'hétérominibody a été purifié à partir de cellules CHO
transfectées de manière stable, par échange de cations et
Chromatographie d'affinité pour le chelate de cobalt. Comme le
35 montre la figure 59 (bande 1) , cette purification a donné une98
bande évidente avec un poids moléculaire apparent de 116 kDa
après SDS-PAGE dans des conditions non réductrices, suivi par
coloration par bleu Coomassie. Le fait que cette bande soit
identique à 1'hétérominibody correctement assemblé a été
5 démontré par Western blott au moyen d'un anticorps biotinylé
spécifique pour le domaine Ck humain (Pierce, Cat. n° 31780).
L'anticorps a été détecté par un conjugué
streptavidine/phosphatase alcaline (DAKO, Cat. n° D0396).
L'immunocoloration pour Ck a co-migré avec la bande de 116 kDa
10 colorée par bleu Coomassie (figure 59, bande 2). Le poids
moléculaire de 116 kDa est compatible avec la somme des poids
moléculaires calculés des chaînes HD70-CH1?GM-CSF (54,4 kDa) et
HD70?Ck?IL-2 (55,4 kDa). Les groupements hydrate de carbone liés
aux sites de N-glycosylation dans les deux domaines VH HD70
15 peuvent être la cause de la différence de 6,2 kDa. Comme le
montre le Western blott, la molécule d'hétérominibody de 116 kDa
était également immunoréactive avec les anticorps spécifiques
pour 1'IL-2 humaine (figure 59, bande 3) et le GM-CSF humain
(bande 4) . Ces données montrent qu'il est possible de produire,
20 dans des cellules CHO, une molécule d'hétérominibody
correctement assemblée qui est immunoréactive pour deux
cytokines distinctes.
La production d'hétérominibodies pharmaceutiquement utiles exige
que les domaines effecteurs attachés par les extrémités N- et C-
25 terminales conservent leurs propres activités biologiques. Afin
de tester si les cytokines GM-CSF et IL-2 attachées sur les
extrémités C-terminales étaient toujours biologiquement actives
dans 1'hétérominibody, leur activité a été déterminée par un
essai de prolifération. IL-2 et GM-CSF peuvent initier la
30 prolifération de cellules immunitaires portant leurs récepteurs
respectifs de haute affinité. De l'hétérominibody purifié a été
ajouté aux cultures cellulaires de TF-1 (lignée de cellules dans
1'érythroleucémie humaine, fournie par DSMZ, Braunschweid,
Allemagne) et CL96 (lignées de cellules T de souris, décrites
35 dans : Marcucci (1981) Nature 291, 79-81) qui prolifèrent en99
réponse au GM-CSF humain et à l'IL-2 humaine, respectivement.
Dans les deux cas, la prolifération cellulaire, telle que
mesurée par le réactif WST-1 (Boehringer, Mannheim, Cat. n°
1644807), a été induite par GM-CSF dans les cellules TF-1 (fgure
5 60) et par IL-2 dans les cellules CL96 (figure 61) sous une
forme dans laquelle les cytokines sont physiquement liées aux
extrémités C-terminales de l'hétérominibody (figures 53) . Ceci
montre que les deux fonctions effectrices aux deux positions C-
terminales de 1'hétérominibody peuvent conserver toute leur
10 activité biologique.
En résumé, il a été montré que la forme d'hétérominibody permet
la production de molécules multivalentes, hautement actives, qui
peuvent avoir jusqu'à quatre domaines effecteurs fonctionnels
attachés à leurs positions d'extrémités N- et C-terminales. Il
15 est considéré que maintenant d'autres domaines effecteurs
peuvent être ajoutés sur les extrémités N- et C-terminales des
domaines effecteurs attachés (voir figure 52).Tableau 1
100
Anticorps Type Société Cat. n° Dilution
anti CD54 humain lgl souris Immunotech 0544 1:1000
anti CD58 humain lgG2 souris Immunotech 0861 1:1000
anti CD80 humain IgGl souris Immunotech 1449 1:1000
anti CD86 humain IgGl souris Systèmes RSD MB141 1:1000
Conjugué IgG anti souris peroxydase chèvre Dianova, Hambourg 115-037-071 1:5000
anti Ck humain biotinylé chèvre Pierce 31780 1:1000
Streptavidine Dako, Hambourg P0347 1:1000
Tableau 2
101
Cellules T Concentrations en hétérominibody M79scFvCK/CD80CHl Concentration de l'anticorps bispécifique simple chaîne M79scFv-antiCD3scFv
CD4+CD45RO- 500ng/ml 250ng/ml
CD4+CD45RO- 500ng/ml 50ng/ml
CD4+CD45RO- 500ng/ml 1Ong/ml
CD4+CD45RO- 500ng/ml 2ng/ml
CD4+CD45RO- 500ng/ml Ong/ml
CD4+CD45RO- Ong/ml 250ng/ml
CD4+CD45RO- Ong/ml 50ng/ml
CD4+CD45RO- Ong/ml 1Ong/ml
CD4+CD45RO- Ong/ml 2ng/ml
CD4+CD45RO- Ong/ml Ong/ml
CD4+CD45RO-sans cellules CHO positives pour 17-lA 500ng/ml 250ng/ml
PBMC 500ng/ml 250ng/ml
PBMC Ong/ml 250ng/ml
PBMC Ong/ml Ong/ml
Tableau 3
102
Cellules T Concentrations en hétérominibody CD80 Concentration en M79SCFV-ANTICD3
CD8+CD45RO- 500ng/ml 250ng/ml
CD8+CD45RO- 50Ong/ml 50ng/ml
CD8+CD45RO- 500ng/ml 1Ong/ml
CD8+CD45RO- 500ng/ml 2ng/ml
CD8+CD45RO- 500ng/ml Ong/ml
CD8+CD45RO- Ong/ml 250ng/ml
CD8+CD45RO- Ong/ml 50ng/ml
CD8+CD45RO- Ong/ml 10ng/ml
CD8+CD45RO- Ong/ml 2ng/ml
CD8+CD45RO- Ong/ml Ong/ml
CD8+CD45RO-sans cellules CHO positives pour 17-lA 500ng/ml 250ng/ml
PBMC 500ng/ml 250ng/ml
PBMC Ong/ml 250ng/ml
PBMC Ong/ml Ong/ml
Tableau 4
103
Anticorps Type Conjugaison Société Dilution
anti CD45R0 IgG2a Isothiocyanate DAKO, Hambourg, 1:50
humain souris de fluorescéine (FITC) Allemagne
anti CD45RA IgGl R-Phyco- Coulter 1:50
humain souris érythrine (PE) Immunotech
Isotype IgG2a FITC Coulter 1:25
IgG2a souris Immunotech
Isotype IgGl PE Coulter 1:100
IgGl souris Immunotech
anti CD4 IgG2a TRI-COLOR® Caltag, 1:50
humain souris distribué par Medac, Hambourg
anti CD8 IgG2a TRI-COLOR® Caltag, 1:200
humain souris distribué par Medac, Hambourg
104
REVENDICATIONS
1. Composé multifonctionnel, apte à être produit dans une cellule hôte de mammifère
sous forme d'un hétérodimère polypeptidique pouvant être sécrété et totalement
fonctionnel, formé de deux chaînes polypeptidiques, dans lequel une desdites chaînes
polypeptidiques comprend en tant que seul domaine de la région constante d'une chaîne
lourde d'une immunoglobuline le domaine Chi et l'autre chaîne polypeptidique
comprend le domaine Cl de la chaîne légère d'une immunoglobuline, ledit composé
multifonctionnel comprenant en outre au moins deux et jusqu'à quatre (poly)peptides
ayant des fonctions de récepteur ou de ligand différentes, fusionnés avec lesdits
domaines de région constante, dans lequel, en outre, au moins deux desdits
(poly)peptides différents sont dépourvus d'une affinité intrinsèque l'un pour l'autre et
dans lequel lesdites chaînes polypeptidiques sont liées par l'intermédiaire desdits
domaines constants.
2. Composé multifonctionnel selon la revendication 1, dans lequel les domaines
fonctionnels ayant une fonction de récepteur ou de ligand , sont liés par leur extrémité C-
ou N-terminale auxdits domaines constants d'immunoglobuline.
3. Composé multifonctionnel selon la revendication 1 ou 2, comprenant au moins trois
domaines fonctionnels ayant des fonctions de récepteur ou de ligand.
4. Composé multifonctionnel selon l'une quelconque des revendications 1 à 3,
comprenant quatre domaines fonctionnels ayant des fonctions de récepteur ou de ligand.
5. Composé multifonctionnel selon l'une quelconque des revendications 1 à 4, dans
lequel au moins deux domaines ayant des fonctions de récepteur ou de ligand sont liés
par leur extrémité N-terminale auxdits domaines constants d'immunoglobuline.
6. Composé multifonctionnel selon l'une quelconque des revendications 1 à 5, dans
lequel au moins un desdits domaines ayant des fonctions de récepteur ou de ligand est
sous la forme d'un fragment scFv ou d'une de ses parties fonctionnelles.
7. Composé multifonctionnel selon l'une quelconque des revendications 1 à 6, dans
lequel au moins un desdits domaines ayant des fonctions de récepteur ou de ligand est un
ligand co-stimulateur d'une cellule T, une région de liaison à un antigène spécifique105
d'un antigène associé à une tumeur ou un composé protéinique fournissant le signal
d'activation primaire pour des cellules T.
8. Composé multifonctionnel selon l'une quelconque des revendications 6 ou 7, dans
lequel ledit fragment scFv ou sa partie fonctionnelle comprend les régions Vh et Vl de
l'anticorps murin anti-17-lA humaine, M79, les régions Vh et Vl de l'anticorps anti-
Lewis Y, tel que représenté à la Fig.6, les régions VH et VL de l'anticorps anti-CD3
TR66, et/ou les régions VH et VL de l'anticorps humain anti-EpCAM humaine tel que
représenté à la Fig.55.
9.Composé multifonctionnel selon la revendication 7, dans lequel le ligand co-
stimulateur des cellules T est une molécule de surface cellulaire ou un de ses fragments
exprimée sur des cellules présentatrices d'antigène.
10. Composé multifonctionnel selon la revendication 9, dans lequel la cellule
présentatrice d'antigène est une cellule dendritique.
11. Composé multifonctionnel selon la revendication 9, dans lequel la molécule de
surface cellulaire est choisie dans le groupe consistant en B7-1, B7-2, ICAM-1, ICAM-
2, ICAM-3, LFA-3 et le ligand de CD-137.
12. Composé multifonctionnel selon l'une quelconque des revendications 1 à 5, dans
lequel au moins un desdits domaines, ayant une fonction de récepteur ou de ligand est
une molécule effectrice immuno-modulatrice ou un de ses fragments.
13. Composé multifonctionnel selon la revendication 12, dans lequel ladite molécule
effectrice immuno-modulatrice ou son fragment est choisie dans le groupe consistant en
cytokines, chemokines, facteur de migration des macrophages (MIF), récepteurs de
cellules T et molécules solubles du CMH.
14. Composé multifonctionnel selon la revendication 13, dans lequel ladite cytokine est
choisie dans le groupe consistant en interleukines, interférons, GM-CSF, G-CSF, M-
CSF, TNFs et VEGF.
15. Composé multifonctionnel selon la revendication 13, dans lequel ladite chémokine
est choisie dans te groupe consistant en IL-8, eotaxine, GROct, GROß, GROy, IP10,106
MCP-1, MCP-2, MCP-3, MCP-4, MIG, MlP-la, MIP-Iß, NAP-2, RANTES, 1309,
lymphotactine et SDF-1.
16. Composé multifonctionnel selon l'une quelconque des revendications I à 5, dans
lequel au moins un desdits domaines ayant une fonction de récepteur ou de ligand est le
ligand FAS (CD95L) ou un de ses fragments.
17. Composé multifonctionnel selon l'une quelconque des revendications 1 à 5, dans
lequel au moins un desdits domaines ayant une fonction de récepteur ou de ligand est un
facteur de croissance ou un de ses fragments.
18. Composé multifonctionnel selon l'une quelconque des revendications 1 à 5, dans
lequel au moins un desdits domaines ayant une fonction de récepteur ou de ligand est un
inhibiteur de l'angiogénèse ou un de ses fragments.
19. Composé multifonctionnel selon l'une quelconque des revendications 1 à 18, dans
lequel ledit domaine constant d'une chaîne légère d'immunoglobuline est de type k.
20. Composé multifonctionnel selon Tune quelconque des revendications 1 à 19, dans
lequel lesdits domaines constants d'immunoglobuline et lesdits domaines fonctionnels
récepteur-ligand sont reliés au moyen d'un fragment de liaison polypeptidique.
21. Composé multifonctionnel selon la revendication 20, dans lequel ledit fragment de
liaison polypeptidique comprend une région charnière d'Ig ou plusieurs glycines,
alanines, et/ou serines.
22. Composé multifonctionnel selon la revendication 21, dans lequel ladite région
charnière d'Ig est une région charnière d'IgG.
23. Composé multifonctionnel selon la revendication 22, dans lequel ladite région
charnière d'IgG est la région charnière supérieure d'IgG3.
24. Composé multifonctionnel selon l'une quelconque des revendications 1 à 23, dans
lequel lesdits domaines fonctionnels ayant une fonction de récepteur ou de ligand
comprennent GM-CSF, IL-2 et/ou un(des) fragment(s) scFv comprenant les régions VH
et Vl de l'anticorps humain anti-EpCAM humaine, tel que représenté à la Fig.55.107
25. Composé multifonctionnel selon la revendication 24, dans lequel lesdits GM-CSF et
IL-2 sont liés par l'intermédiaire de leur extrémité C-terminale auxdits domaines
constants Chi ou Cl et dans lequel le(s) dit(s) fragment(s) scFv comprenant les régions
Vh et VL de l'anticorps humain anti-EpCAM humaine est(sont) lié(s) par l'intermédiaire
de leur extrémité N-terminale auxdits domaines constants CHi ou CL.
26. Composé multifonctionnel selon l'une quelconque des revendications 1 à 25, dans
lequel ledit domaine Chi est limité à une étiquette histidine, GST, la protéine A de
Staphylococcus, Lex A, une étiquette FLAG ou une étiquette MYC.
27. Composé multifonctionnel selon l'une quelconque des revendications 1 à 26, dans
lequel lesdits domaines fonctionnels, ayant une fonction de récepteur ou de ligand est ou
sont dérivés d'un domaine non-immunoglobuline.
28. Polynucleotide codant pour les deux chaînes polypeptidiques du composé
multifonctionnel tel que défini dans l'une quelconque des revendications 1 à 27.
29. Vecteur comprenant au moins un polynucleotide selon la revendication 28.
30. Cellule hôte de mammifère comprenant au moins un vecteur selon la revendication
29.
31. Cellule hôte de mammifère selon la revendication 30 qui est une cellule CHO ou une
cellule de myélome.
32. Méthode de production d' un composé multifonctionnel selon Tune quelconque des
revendications 1 à 27, comprenant la culture de la cellule hôte selon la revendication 30
ou 31 dans des conditions qui permettent la synthèse et la sécrétion dudit composé
multifonctionnel, et la récupération dudit composé multifonctionnel à partir de la
culture.
33. Composition comprenant le composé multifonctionnel selon l'une quelconque des
revendications 1 à 27, le polynucleotide selon la revendication 28 ou le vecteur selon la
revendication 29, et, éventuellement, un composé protéinique capable de fournir le
signal d'activation primaire pour des cellules T.108
34. Composition selon la revendication 33, qui est une composition pharmaceutique
comprenant en outre, éventuellement, un support pharmaceutiquement acceptable et/ou
un diluant et/ou excipient.
35. Composition selon la revendication 33, qui est une composition de diagnostic
comprenant en outre, éventuellement, des moyens appropriés à la détection.
36. Utilisation d'un composé multifonctionnel selon Tune quelconque des
revendications 1 à 27, du polynucleotide selon la revendication 28 et/ou du vecteur selon
la revendication 29, pour la préparation d'une composition pharmaceutique pour la
prévention et/ou le traitement de la croissance de cellules malignes.
37. Utilisation selon la revendication 36, dans laquelle la croissance de cellules malignes
est liée à des états malins des cellules hématopoïétiques ou à des tumeurs solides.
38. Utilisation selon la revendication 37, dans laquelle lesdits états malins de cellules
hématopoïétiques sont des lymphomes ou des leucémies.
39. Utilisation selon la revendication 37, dans laquelle lesdites tumeurs solides sont des
carcinomes, des mélanomes ou des sarcomes.
40. Kit comprenant le composé multifonctionnel selon l'une quelconque des
revendications 1 à 27, et, éventuellement, un composé protéinique capable de fournir le
signal d'activation primaire pour des cellules T.
41. Composition selon la revendication 33, composition pharmaceutique selon la
revendication 34, composition de diagnostic selon la revendication 35 ou kit selon la
revendication 40, dans lesquels le composé protéinique capable de fournir le signal
d'activation primaire pour des cellules T est un anticorps bispécifique interagissant avec
l'antigène CD3 des cellules T.1/75
/
ï Région charnière
d'IgG3
Etiquette
histidineB
2/75
Région charnière
d'IgG3
Etiquette
histidine3/75
D
CHI humain
Etiquette
histidine
Région
charnière
d'IgG3
CK humain
CK humain
Région
charnière
d'IgG3
CHI humain
Etiquette
histidine
CHI humain
Etiquette
histidine
ion
charnière
d?IgG3
humain
CK humain
Région
charnière
d'IgG3
CHI humain.
Etiquette
histidine4/75
H
CHI humain
charnière
humain
Etiquette
histidine
CK humain
Région
charnière
humain
Etiquette
histidine
CHI humain
Région
charnière
d*IgG3
CK humain
Etiquette
histidine
CK humain
Etiquette
histidine5/75
Figure 2
EcoRI
t~~ ?"- »
Xbaf AsuII BspEl BamHI EcoRV Xmal
5' CTA GAA TTC TTC GAA TCC GGA GGT GGT GGA TCC GAT ATC CCC GGG
Sail
CAT CAT CAC CAT CAT CAT TGA G 3'6/75
^ EcoRJ
.1
pEF-ADA 5
M79VL -
M79VH
BspEJ Nhel SaU
ijCharnière|4| ~^t |J Tir
Charnière
d*IqG3
CHI
{
EcoRI
BspEl BsiWl
pEF-DHFR5
i
CD8Ö
yfcharnière
d'IqG3
A
CK
Etiquette
histidine
SaU
L
B
EcoRJ
p^-DHFR5
A
M79VL
M79VH
BspEl BaWI
jr JCharnièrlThrf
"harnière
d'IqG3
CK
SaU
3'
l,
EcoRI
BspEl Nhel
pEF-ADA 5
j,
CD8Ö
J,
1
Charnière d»IqG3 CHI
SaU
4-
Etiquette
histidine
EcoRI
pEF-ADA 5
.1
CD54
BspEl Nhel
jfc Charnière [x..
Charnière
d*IqG3
CHI
H
SaU
i
Etiquette
histidine7/75
D
pEF-DHFR
EcoRI
À
CD54
BspEl BsiWl
""] ylCharnièrew P""
Charnière
d'IqG3
CK
SaU
-3'
i,
EcoRI
pEF-ÀDA5
h
CD58
BspEl Nhel
""[y Charnière | ~
CHI
SaU
4
Etiquette
histidine
EcoRI
pEF-DHFR5
.1
CD58
BspEl BsiWI
r-| Charnière
d'lqG3
;
i CK
SaU
-3'
I
G
pEF-ADA 5
EcoRI
.Jr
CD86
BspEl Nhel
~ >lr[Charnière|y p
Charnière
d'IqG3
CHI
SaU
A-
Etiquette
histidine8/75
H
EcoRJ
pEF-DHFR5
?i
CD86
BspEÏ
BsiWI
JC Charnière J^
Charnière
d*IqG3
CK
SaU
L
EcoRI Anti-Ley BspEl
?A-
pEF--AE>A;5
j,
f*
Nhel
^
VL
EcoRI
pEF-DHFR5'
VH
t ? Charnière, J£
Charnière
d*IqG3
CHI -
Sali
i
Etiquette
histidine
CD80,
BspEl BsiWI SaU
CK F-3'
charnière
.d'IqG3
EcoRI
pEF-DHFR5
i
EcoRI
pEF-ADA 5
i
Anti-Ley
-A,
VL
CD80
VH
BspEl BsiWI
:l.L______J.________,1
J Charnière J ^^ LiV
Charnière
d'IqG3
CK
BspEl
Nhel
jrjCharnièrelY.
Charnière
d'lgG3
CHI
Sa»
3'
SaU
ni.
Etiquette
histidine9/75
O)
il
4J
0)
G
<M
00 CD ^ CSI
o O O o
D.O. 405 nm
10/75
U>
S
3
O)
? O

^ O cm* o .e - c (1) » s Ö? 8 CD ? O O CM o
Ü
? m
m r-
CM S
- 5 f
* .g
«> -d
CM 5
O, o O Ju CO
ï' p. H
f 13
?
f " 5 1
§
? . o t!
'i (0
1 O m
I +j
1 0,008 Concen
1 0,004
i neg

rCMOÖOCOTTCgO
? T? T?
Can al moye n
11/75
Figure 5
ZC0?,Z 10 19 23 . 37 4$ S5
5 ' GAAT TCC ACC ATG GGA TSG AGC TGT ATC ATC CTC TTC TTG GTA GCA ACA GCT ACA
MGW5CI ILFLVATAT
64 73 82 51 100 i09
GGT GTA -CAC TCC GAT ATC GTT GTG ACT CAG GAA TCV GCA CTC ACC ACA TCA CCT
GVHSD IVVTQS3AE.TTSÎ
--------......1X8 127- ......- -1-3S.....? - -- 145' 154 153
GGT GAA ACA GTC ACA CTC ACT TGT CGC TCA AGT ACT GGG GCT GTT ACA ACT AGT
GETVT LTCRSSTGAVTTS
172 181 190 199 208 217
AAC TAT GCC AAC TGG GTC CAA GAA AAA CCA GAT CAT TTA TTC ACT GGT CTA ATA
SJYAtfWVQï KPDHLFTüLX
225 235 244 253 2S2 271
GGT GGT ACC AAC AAC. CGA GTT CCA GGT GTT CCT GCC AGA TTC TCA GGC TCC CTG
GGTNKP.VPGVPA?. TSGSL
230 239 298 307 315 325
ATT GGA GAC AAG GCT CCC CTC'?.ACC ATC ACA GGC- GCA CAG ACT GAG GAT GAG GCA
IGDKA.ALTITGAQTEDEA
334 343 352 351 370 379
ATA TAT TTC TGT GCT CTA TGG TAC AGC AAC CAT TGG GTG TTC GGT GGA GGA ACC
I Y r C A L W Y S M K W V r G G G T
3B3 397 406 . 41S 424 433
AAA CTC GAG GTC CTA GGT GGT GC-T GGT TCT GGC GGC GGC GGC TCC GGT GGT GGT
KLSVLGGGGSGGGG3GGG
442 451 450 459 473 437
GGT TCT CAG GTC CAG CTG CAG GAG TCT GGA CCT GGC CTG GTC- CCG CCC TCA CAG
GSQVQI,Q£5G?GLVA?SQ12/75
4=5 505 514 523 532 541
AGC CTG TCC A.TC AC1- "TGC ACC ATC TCA GGG TTC TCA TTA. ACT AAG TAT GGT GTA
SLS ITCTZSG?SLTKrc-V
550 -. 559 5S3 5*7 535 5 = 5
CAC TGG GTT CGC CAG CCT CCA GGA AAG GGT CTG GAG TGG CTG GTG GTG ATA TGG
H W V ?. Q ? ? G . K G L Z W ü V V X it
604 513 522 531 540 ' 543
ACT GAT GGA COC ACA TCC TAT AAT TCA GCT CTC AAA TCC AGA CTG AGC ATC AGC
'r' DGGTS VJfS AL X 5 RL'S î S
658 557 575 535 694 703
AAG GAC AA.C TOC AAG AGC CAA GTT TTC TTA AAA A"G AAC AGT CTC CAA ACT GAT
K D it S :<S QVFLXMSfSLQTD
712 721 730 73." 74a 757
GAC ACA GCC ATG TAC TAC TGT GCC AGA CAG GAT AGA TAC GAC GGT GGA ATT GCT
D T A M y Y C A P. Q D . ?. y O G G I A
765 775 734 3saS.I_
TAC TGG GGC CAA GGG ACC A.CG GTC ACC GTC TCC TCC GGA 3 '
YWGQGTT'VTVSS13/75
Figure 7
Hétérominibody Hétérominibody Contrôle négatif
LeYscFvCHl/CD80CK LeYscFvCK/CD80CHl
Hétérominibody Hétérominibody Contrôle négatif
LeYscFvCHl/CD80CK LeYscFvCK/CD80CHl14/75
CO CM '
S N TS » t: «- S o
r- -r- -r-: c d
m
d ?
E»)
D
<D
3
Ol
Li.
D.O. 405 nm15/75
S,
co
E
^J- CM
O O O O
D.O. 405 nm16/75
Figure 11
01W ».....
a
3
O
O
-M79 sur cellules CHO transfectées par 17-lA
? M79 sur cellules CHO non transfectées
? M79 sur cellules KATO17/75
1?
«
3
S
u.
>
[m
U
m
ro
Q
U
-h
±J
d
ta
i
>
Uj
O
m
CD
r-
C
a>
c
o
-H
4-»
[0
+J
c
O)
o
c:
o
o
D.O. 405 nm18/75
CO
'T?
2
E
**.
o o o o o o o o o o
o o* co t-» o Ul "V « et ^
\
?
^
<fe
%
"\
^
\
r-(
e
c
tj o
I- *fe
X
o
o
axt
o
XI co
?H Q
C ü
e ^
O U
u >
% de cellules T oontées19/75
il
>
Pu
U
m
ro
Q
U
?r-f
+J
C
(0
>
Du
O
m
en
r-
2
C
<D
c
O
-H
-P
en
M
-U
C
(D
O
C
o
L)
% de cellules T Dontées20/75
i
il
o
o
O
O
o
Q O O
OOO
co <o ^r
o" o" o"
D.O. 405 nm
CM
O"21/75
CO
£
3
E
%

%
**
?%
%
%
^
<&
'<&
%
%
/i
%

%
\.
*
?fe
r-1
o
o
OQ
Q
u
o
^ 2
\
X
%
X
$*
>1
TI
o
?H
d
?H
§
o
?U
.d
tn
d
o
o
m
to
D
i-H
Û.
>
Pu
O
tn
ro
Q
O
-H
4->
C
ni
I
>
Du
U
m
m
r-
d
tp
d
o
-H
-P
ro
d
0)
u
d
o
o22/75
^
2
O)
E
ca co N <o «) f <o <M t- o
o" o* cf o* o" ö" o* o" o
D.O. 405 nm
%
a23/75
CO
I
3
O)


-? ?
? ? p
1 i i m
1 ; - ? j Jl
î* i H
'v. ! t * I. 1 i n



"%
^
*
>? °
%
%
cy
*r*
%
%
<2?


^
%
%
>
Pu
O
tfi
rO
a
X u
o i
o *->
c
Q rO
U 1
^s. >
Ü tu
U Ü
> «î
Cu CT»
U r-
m s
CT\
r- d
S eu
>, d
TJ o
0 -H
X) -p
?H ro
d Jh
?r-f -P
e d
o Q)
M o
O d
-P o
'CU u
.d
?o
<-(
e
\
CP
d
o
o
m
w
D
-H
a
Diam. ext. 405 nm24/75
%

OV
ï
\
?
'%
b
V
\
?%
<s>

%
o
o
o"
o*
CM
%
X
Tv
\

%
%
4,
%
%>,
%
U
O
?
Q
O
>
tu
O
co
CTi
r-
2
>,
TJ
O
-H
d
?H
e
o
X ^
^
%
^
%.
^
%
^
?\
Diam. ext. 405 nm
tn
d
o
o
m
p
r-\
a
>
Pu
U
m
co
Q
O
?<H
?P
d
ai
t
>
Pu
O
01
en
r-
2
d
a>
d
o
?H
-P
ro
Jh
P
d
<u
o
d
o
o25/75
o
3'
i?
Pourcentage de cellules pontées26/75
CM
S
3
O)
ooooo oooooo
O O) CO h. <o «? 't n N r
Pourcentage de cellules pontées
%
to
D
?H
Q.27/75
CM
CM
fi
3
O)
Ü.
o
o
p*
o"
(O
o"
o o o o
o o o o
IO "^ CO Ol
o* o" o" o
o
o
o
Diam. ext. 405 nmFigure 23
28/75
Fragment de
liaison Gly4Serl
%,
rnière
quette
histidineFigure 24
29/75
Protéine bifonctionnelle recombinante simple chaîne
Extrémité N-terminale
"\
Partie extracellulaire
V CD 80 (B7-1)
(domaines I + II)
J
L_ Fragment de liaison Gly-Ser
Fragment Fv simple chaîne
d'un anticorps anti 17-lA
^_ Queue poly histidine (His)6
Extrémité C-terminale30/75
Figure 25
EcoRI BspEl EcoRV
5'? j .CD 80 f-(Gly4Seri)H VL M79f-(Gly4Seri)^VHM79 [
Sail
Ir
Etiquette
histidine
EcoRI BspEl EcoRV
ir?i^ I
'-1 men -/r.N^cor^,
5b//
5'^CD80 -(Gly4Seri)v VHM79 -<GIy4Seri)j VLM79
-3'
Etiquette
histidine
EcoRI BspEl EcoRV
Jr?J -i
? * 'Inn OA L/^l-. .O___\2;
Ali/
5'-*\CD 80 f-(Gly4Seri)3^jVHM79|-(Gly4Scr1)3-
VLM79
-3'
Etiquette
histidine31/75
Figurê26
o
e
ro
?ri
Q
Analyse ELISA
CD80-M79scFv (VL/VH) avec fragment de liaison court
Détection : anti étiquette histidine
?pur
E 1:2
? 1:4
D1:8

%iM
m
surnageant
contrôle nég.
controle pos.
o
S
ro
?H
Q
Figiire 27 Analyse ELISA
CD80-M79scFv (VL/VH) avec fragment de liaison court
Détection : anti-CD80
Jjpur
m 1:2
01:4
? 1:8
surnageant
controle nég.
contrôle pos32/75
FlgUre28 Analyse ELISA
CD80-M79scFv (VL/Vh) avec fragment de liaison court
Détection : anti étiquette histidine ou anti-CD80
(comme indiqué)
surnageant
contrôle nég.
V
Détection : anti
étiquette histidine
surnageant contrôle pos.
S ?? ? ^ .... ???*
Détection : anti-CD80
Figure 29
m
o
O
Analyse ELISA
CD80-M79scFv (VH/VL) avec fragment de liaison court
Détection : anti-CD80
surnageant
contrôle nég.
contrôle pos.33/75
Figure 30
Séquence ADN de l'oligonucléotide à double brin désigné
ACCGS15BAM
BspEl
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
5' pCC GGA GGT GGT GGT TCC GGG GGT GGA GGT TCA GGC GGT GGT G 3'
3'
T CCA CCA CCA AGG CCC CCA CCT CCA AGT CCG CCA CCA CCTÀG 5
BamHI
m
o
O
Q
Figure 31
Analyse ELISA
CD80-M79scFv (VH/VL) avec fragment de liaison long
Détection : anti étiquette histidine
surnageant
contrôle nég.
contrôle pos.34/75
Figure 32
EcoRI BspEl BsiWI s*cl
_i
Xbal
pEF-DHFR S^79VL.v^i
IngeIgG3
i
GK
- Gly4Serl
AfltiCD3 VH-VL *3
i
EcoRI
pEF-ADAS
? A
CD8Û
BspEl Nhel
~| yiCharnièreiy
Charnière
d'IgG3
CHI
SaU
Ji.'
Etiquette
histidine35/75
Figure 33
Changement de
phénotype
CD45 RA+/R0- cellules T naïves
Amorçage
1
CD45 RA-/RO+ cellules T effectrices/à mémoire
PBMC
, cellules T CD4+ naïves
y iJ^UW ?-..-? ????I
10° 101 HT 103 10*
CD45RO
iiwr'wrf»
10° 10' MY 103 10'
CD45RO
séparation 4*m
jour 0
jour 6
A^**t>.i
10° IO1 l'O2 103 tO4
CD45RO
o
wo*
A S
D ~ *#:??
10° 101 IO2 tO3 104
CD45RO
seulement signal primaire
M79scFv-antiCD3scFv
signal primaire + co-
stimulateur : hétérominibody
M79scFv-antiCD3scFv et
M79scFvCK/CD80CHl36/75
Figure 34
Changement de
phénotype"
CD45 RA+/R0- cellules T naïves
Amorçage
I
CD45 RA-/R0+ cellules T effectrices/à mémoire
PBMC
cellules T CD8+ naïves
o
séparation
jour 0
C
DSI
cd*-:..
rs;
? ^ umi irw«
io° wx to2 îtrio4
CD45R0
rrw« r*i«w« )??«?(.????
10" 10' ir 10j to4
CD45RO
4 *~
5~S
A - r-'--
o.
jour 6
10° 101 10- IO3 w
GD45RO
seulement signal primaire
M79scFv-antiCD3scFv
10° 101 IO2 103 104
CD45RO
signal primaire + co-
stimulateur : hétérominibody
M79scFv-antiCD3scFv et
M79scFvCK/CD80CHl37/75
Q) d)
c* o>
ro ro
o o-
u u
o o
e ë
ro ra
O
c -<u S
ro m > a ai ca CL D
I
X
o
o
oo
Q
O
IO
CO
<D
t-
D)
il
o
to
o
m
CM
o
o
to
O
O
O
lO
O
O
CO
O
CM
lyse spécifique (%)
M
3
4J
?H
3
O
I
O
O
I
>
U-
O
W
a
>
o
w
Q
*->
c
tcFigure 36
38/75
46kD
97kD
66kD
46kD

non red.39/75
o m
u ® rf S*
les 'M "^
ellu rans par
o -p
c
o
C m
0)
O *<P
a: 4J
O o
eu
tn <w
d) (0
?H C
3 <0
M H
-H 4J
O
Ü
co
£
3
O)
il
Cfr
OC
Coups
40/75
X
O
o
co
û
ig
ULI-
£&
OU
2 +
u.
O
1
CS
I I \ 1 I I I \ I
001
08
09

Ob
03
Coups
CO
CO
2
u.41/75
1 1
!
. î
i
l

»
t i
en
co
£
3
cl
CD
3
O
O
O
o
Cs!
u
o
?
o
u
>
Uj
O
m
a\
r-
2
>i
?O
O
.Q
?H
C
?H
6
O
u
?4)
+J
.c
c
d>
c
o
-H
JJ
ro
tH
-p
c
a>
o
c:
o
o
CO
m
o"
cm m t-
o" *""- o"
o
D.O. 405 nm
in
o42/75
O
3
m
O
CM
O
..
T
i
!

1
;
:



.
i


7
.
!:
1
\
1
0
-O
c
o
<o
M
?P
G
O
O
Q.
i
CO
00 O 8- 3
O O O
D.O. 405 nm
CN
O43/75
KT

LE
0
c
0>
rH
O
M
+J
C
O
Ü
Q.
S"
<
CO
GL
E
<
£
<
IL
D.O. 405 nm44/75
Figure 42
contrôle nég.
50 (ig/ml d'hétérominibody
400 ug/ml d'hétérominibody
T
~b
FL-145/75
Figure 43
anti-
CDSscFV
charnière
Etiquette
histidine46/75
Fig 44
EcoRI
BspEl
pÉF-DHFRS
3^VI^VI^^4SèrinÂttû
lAirtiCD3VH-VÜ
BspEl BsiWI Xbal
fcö Charnière« TZ » Y
Charnière
d'IgG3
OC
EcoRI
pEF-ADA5
?J[
CDSO
BspH Nhel SaU
nJrtCharniêrebrJ _,. Il LXî'
n d'lgG3 ]\ *-"' f\ 1 J
Etiquette
histidineFigure 45
47/75
O
Ë
ro
?H
a
PS
contrôle nég,
Figurë46
PS
1.Amp
contrôle nég48/75
Figure 47:
EcoRI
'-----*------* 9 18 27 36 45 54
5' GAA TTC ACC ATC GGA TCGAGCTGTATCATCCTCTTCTIGGTA GCA ACA GCT ACA
MGWSCIILFLVATAT
63 72 81 - 90 99 108
GGT GTA CAC TCC GAT ATC CAG CTG ACC CAG TCT CAA AAA TTC ATG TCC ACA TCA
GVHSD IQLTQSQKFMSTS
117 126 135 144 153 162
GTA GGA GAC AGG GTC AGC GTC ACC TGC AAG GCC AGT CAG AAT GTG GGT ACT AAT
VGDRVSVT c" K A s" Q*" N "V~"*G..... T N
171 180 189 198 207 ?? 216
GTA GCC TGG TAT CAA CAG AAA CCA GGG CAA TCT OCT AAA GCA CTG ATT TAC TCG
VAWYQQKPGQSPKALIYS
225 234 243 252 261 270
GCA TCC TAC CGG TAC AGT GGA GTC CCT GAT CGC TTC ACA GGC AGT GGA TCT GGG
AS YRYSGVPDRFTG S G S G
279 288 297 306 315 324
ACA GAT TTC ACT CTC ACC ATC AGC AAT GTG CAG TCT GAA GAC TTG GCA GAG TAT
TD FT LTXSNVQ S E D L A E Y -
333 342 351 360 369 378
TTC TGT CAG CAA TAT AAC AGC TAT CCG CTC ACG TTC GGT GCT GGG ACC AAG CTC
FCQQYNSYPLTFGAGTKL
387 396 -405 414 423 432
GAG ATC AAA GGT GGT GGT GGT TCT GGC GGC GGC GGC TCC GGT GGT GGT GGT TCT
EIK'GGGGS'GGGGSGGGGS
441 450 459 468 477 ' 486
CAG GTG AAA CTG CSG GAG TCA GGA CCT GGC CTA GTG CAG CCC TCA GUS AGC CTG
QVKLQESGPGLVQPSQSL
495 504 513 522 531? 540
TCC ATC ACC TGC ACA GTC TCT GGT TTC TCA TTA ACT AGC TAT GGT GTA CÀC TGG
SXTCTVS.GF3LTSYGVHW
549 558 S67 576 585 594
GTT CGC OG TCT CCA GGA AAG GOT CTG GAG TGG CTG GGA GTG ATA TGG AGT GGT
V R Q S PGKGX.EWLGVIWSG
603 512 621 630 639 543
GGA AGC ACA GAC TAT AAT GCA GCT TTC ATA TCC AGA CTG AGC ATC ÏGC AAG CAC
-GSTDYNAA? 15 ?. L S I S K D .49/75
Figure47 ?H*I?
657 666 675 684 693 702
AAT TCC AAG AGC CAA GTT TTC TTT AAA ATG AAC AGT CTG CAA GCT AAT GAC ACA
NSKSQVFFKMNSLQANDT
' 711 720 729 738 747 756
GCC ATA TAT TAC TGT GCC ACA ATG CAG AAC TGG TCG TTT GCT TAC TGG GGC CAA
AIYYCARMENWSFAYWGQ
765 774 783 792 801 810
GGG ACC ACG GTC ACC GTC TCC GAA TTC CCC AAA CCT AGC ACC CCC CCT GGC AGC
GTTVTVS EF PK P STP P G S
819 828 837 846 855 '*' 864
AGT GGT GAA CTG GAA GAG CTG CTT AAG CAT CTT AAA GAA CTT CTG AAG GGC CCC
SGELEELLKHLKELLKGP
873 882 891 900 903 918
CGC AAA GGC GAA CTC GAG GAA CTG CTG AAA CAT CTG AAG GAG CTG CTT AAA GGT
RKGELEELLKKL.KELLKG
927 936 945 954 963 972
. GGG AGC GGA GGC GCG CCG GCA CCT ACT TCA AGT TCT ACA AAG AAA ACA CAG CTA
GSGGAPAPT5S5TKKTQL
981 990 999 1008 1017 1026
CAA CTG GAG CAT TTA CTG CTG GAT TTA CAG ATG ATT TTG AAT GGA ATT AAT AAT
QLSHLLLDLQMILNG INN
1035 1044 1053 1062 1071 1080
TAC AAG AAT CCC AAA CTC ACC AGG ATG CTC ACA TTT AAG TTT TAC ATG CCC AAG
YKKPKLTRMLTFKFY^HPK
1089 1098 1107 1116 1125 1134
AAG GCC ACA GAA CTG AAA CAT CTT CAG TGT CTA GAA GAA GAA CTC AAA CCT CTG '
KATELKHLQCLEEELKPL
1143 1152 1161 1170 1179 1188
GAG GAA GTG CTA AAT TTA GCT CAA AGC AAA AAC TTT CAC TTA AGA CCC AGG GAC
SEVLNLAQSKNFHLRPRD
1197 1206 1215 1224 1233 1242
TTA ATC AGC AAT ATC AAC GTA ATA GTT CTG GAA CTA AAG GGA TCT GAA ACA ACA
LISNINVIVL.ELKGSETT
1251 1260 1269 1273 1287 1296
TTC ATG TTT GAA TAT GCT CAT GAG ACA GCA ACC ATT GTA CAA TT? CTG AAC ÄGA
FMCEYADETAT I V î F L tf R50/75
Figure47 suite
1305 1314 1323 1332 1341 1350
TGG ATT ACC TTT TGT CAA AGC ATC ATC TCA ACA CTG ACT GAC GTC CAT CRC CAT
WITFCQSIISTLTDVHHK
Sali
1359 i-----'------v
CAC CAT CAC TGA TAA GTC GAC
H H H *Figure 48:
EcoRJ
51/75
18
27
36
45
54
GAA TTC ACC ATG GGA TGG AGC TGT ATC ATC CTC TIC TTC GTA GCA ACA GCT ACA
MGWSCIILFLVATAT
63 72 81 90 99 108
GGT GTA CAC TCC CAT ATC CAG CTC ACC CAG TCT CAA AAA TTC ATG TCC ACA TCA
V
K
M
1" 126 135 144 153 162
GTA GGA GAC AGG GTC AGC GTC ACC TGC AAG GCC AGT CAG AAT GTC GGT ACT AAT
V
D R
V
V
K
N V
N
171 180 ....."189 198 207 216
GTA GCC TGG TAT CAA CAG AAA CCA GGG CAA TCT CCT AAA GCA CTG ATT TAC TCG
V
W
K
K
225 234 243 252 261 270
GCA TCC TAC CGG TAC AGT GGA GTC CCT GAT CGC TTC ACA GGC AGT GGA TCT GGG
V
D
279 288 297 306 315 324
ACA GAT TTC ACT CTCATCATCAGCAATGTCCAGTCT GAA GAC TTG GCA GAG TAT
D
N
333 342 351 360 369 378
TTC TGT CAG CAA TAT AAC AGC TAT CCG CTC ACG TTC GGT GCT GGG ACC AAG CTC
FCQQYNSYPLTFGAGTKL
387 396 405 414 423 432
GAG ATC AAA GGT GGT GGT GGT TCT GGC GGC GGC GGC TCC GGT GGT GGT GGT TCT
EIKGGGGSGGGGSGGGGS
441 450 459 468 477 486
CAG GTG AAA CTG CAG GAG TCA GGA CCT GGC CTA GTC CAG CCC TCA OG AGC CTG
V K
V
495 504 513 522 531 540
TCC ATC ACC TGC ACA GTC TCT GGT TTC TCA TTA ACT AGC TAT GGT GTA CAC TGG
V
H W
549 558 567 576 585 594
GTT CGC CAG TCT CCA GGA AAG GGT CTG GAG TGG CTG GGA GTC ATA TGG AGT GGT
V R
K
W
V
W
G
603 612 621 630 639 643
GGA AGC ACA GAC TAT AAT GCA GCT TTC ATA TCC AGA CTG AGC ATC AGC AAG GAC
T
D
Y
N
A
R52/75
Figure 48 suite
657 666 675 684 693 702
AAT TCC AAG AGC CAA GTT TTC TTT AAA ATG AAC AGT CTC CAA GCT AAT GAC ACA
N* S K S Q V F F K X N S L Q A N D T
711 720 729 738 747 756
GCC ATA TAT TAC TGT GCC AGAATCGAGAACTC&TGGTTTGCTTACTOG GGC CAA
AIYYCARMENWSFAYWGQ
765 774 783 792 801 810
GGG ACC ACG GTC ACC GTC TCC GAA TTC ACC CCG CTG GGT GAC ACC ACC CAC ACC
G T T V T V S" E" p -^ p x* G D T T H T
819 828 837 846 855 864
TCC GGA AAA CCA CTG GAT GGA GAA TAT TTC ACC CTT CAG ATC CGT GGG CGT GAG
SG K PL DGEYFTLQIRGRE
873 882 891 900 909 918
CGC TTC GAG ATG TTC CGA GAG CTG AAT GAG GCC TTG GAA CTC AAG GAT GCC CAG
RFEMFRELNEALELKDAQ
927 936 945 954 963 972
GCT GGG AAG GAG CCA GGG GGG AGC GGA GGC GCG COS GCA OCT ACT TCA AGT TCT
AG KE.P GGSGGA PAPT S S S
981 990 999 1008 1017 1026
ACA AAG AAA ACA CAG CTA CAA CTG GAG CAT TTA CTG CTG GAT TTA CAG ATG ATT
TK.. KTQLQLEHLLLDLQMI
1035 1044 1053 ' 1062 1071 1080
TTG AAT GGA ATT AAT AAT TAC AAG AAT..CCC AAA CTC ACC AGG ATG CTC ACA TTT
LNGINNYKNPKLTRMLTF
1089 1098 1107 1116 1125 1134
AAG TTT TAC ATG CCC AAG AAG GCC ACA GAA CTG AAA CAT CTT CAG TGT CTA GAA
KFYMPKKATELKHLQCLE
1143 1152 1161 1170 1179 1188
GAA GAA CTC AAA CCT CTG GAG GAA GTG CTA AAT TTA GCT CAA AGC AAA AAC TTT
EELKPLEEVLNLAQSKNF
1197 1206 1215 1224 1233 1242
CAC TTA AGA CCC AGG GAC TTA ATC AGC AAT ATC AAC GTA ATA GTT CTG GAA CTA
HLRPRDLISNI NVIVLEL
1251 1260 1269 1278 1287 1296
AAG GGA TCT GAA ACA ACA TTC ATG TCT GAA TAT GCT GAT GAG ACA GCA ACC ATT
KGSETTFMCEYADETATIFigure 48 suite
53/75
1305 1314 1323 1332 1341 1350
GTA CAA TTT CTG AAC ACA TGG ATT ACC TTT T3T CAA AGC ATC ATC TCA ACA CTC
V
N
R
W
: T F C Q S
Sali
1359 1368 1377 <---*---*
ACT GAC GTC CAT CAC CAT CAC CAT CAC TGA TAA GTC GAC
r.
n
a54/75
Figure 49:
EcoRI
,------------. 9 18 27 36 45 54
GAA TTC ACC ATC GGA TGG AGC TGT ATC ATC CTC TTC TTG GTA GCA ACA GCT ACA
M G W S C IILFLVATAT
63 72 81 90 99 108
GGT GTA CAC TCC GAT ATC CAG CTG ACC CAG TCT CCA GCA ATC ATG TCT GCA TCT
GVKSDIQLTQSPAIMSAS
117 126 135 144 153 162
CCA GGG CAA AAG GTC ACC ATC ACC TGC AGG GCC AGC TCA AGT GTT AGT TCC AGT
P G Ë K V T M T C R K~ S ' S " S " V"""S S S
171 180 189 ? 198" 207 ?* 216
TAC TTG CAC TGG TAC CAG CAG AAG TCA GGT GCC TCC CCC AAA CTC TGG ATT TAT
Y L h'-W YQQKSGASPKLWIY
225 234 243 252 261 ' 270
AGC ACA TCC AAC TTG GCT TCT GGA GTC CCT GCT CGC TTC AGT GGC AGT GGG TCT
STSNLASGVPARFSG SGS
279 288 297 306 315 324
GGG ACC TCT TAC TCT CTC ACA ATC AGC AGT GTG GAG GCT GAA GAT GCT GCC ACT
GTSYSLTISSVEAEDAAT
333 342 351 360 369 378
TAT TAC TGC CAG CAG TAC AGT GGT TAC CCG TAC ACG TTC GGA GGG GGG ACC AAG
YYCQQYSGYPYTFGGG TK
337 396 405 414 423 432
CTC GAG ATC AAA GGT GGT GGT GGT TCT GGC GGC GGC GGC TCC GGT GGT GGT GGT
LEIKGGGGSGGGGSGGGG
441 450 459 468 477 486
TCT CAG GTG AAA CTG CAG GAG TCT GGG GCT GAG CTT GTG AAG CCT GGG GCT TCA
SQVXLQESGAELVKPGAS
495 504 513 522 531 540
GTG AAG. CTG TCC TGC AAG GCT TCT GGC TAC ACC CTC ACC AGC TAC TGG TTG CAC
VKLSCKASGYTLTSYWLH
549 5S8 567 576 585 594
TGG GTG AAG CAG TGG CCT GGA CGA GGC CTT GAG TGG ATT GGA. AGG ATT GAT CCC
WVKQWPGRGÏ.EWIGRIDP
503 612 621 630 639 648
AAT AGT GGT GGT ACT AAG TfcC CAT CAG AAG -TTC AAG AGC AAG GCC ACA CTG ACT
N S G G ' T K Y D E '/. F K S K A T L TFigure 49 suifee 5
657 666 675 684 693 702
GTA GAC AAA CCC TCC AGC ACA GCC TAC ATG CAG CTC AGC AGC CTG ACA TCT GAG
VDKPSSTAYMQLSSLTSE
711 720 729 738 747 756
GAC TCT GCG GTC TAT TAT TGT GCA AGA TGG GAC TAC TGG GGC CAA GGG ACC ACG
DSAVYYCARWDYWGQGTT
765 774 783 792 801 810
GTC ACC GTC TCC TCC GCA ACC CCG CTG GGT GAC ACC ACC CAC ACT AGT GGA AAA
___y T V S S G T PL G DTTK T S G K
819 828 837 846 855 864
CCA CTC GAT GGA GAA TAT TTC ACC CTT CAG ATC CGT GGG CCT GAG CGC TTC GAG
PLDGEYFTLQIRGRERFE
873 882 891 900 909 918
ATG TTC CGA GAG CTG AAT GAG GCC TTG GAA CTC AAG GAT GCC CAG GCT GGG AAG
MFRELNEALELKDAQAGK
927 936 945 954 963 972
GAG CCA GGG GGG TCC GGA GGT GGT GGT AGC ACC CAA GTC TCC ACC GGC ACA GAC
EPGGSGGGG STQVCTGTD
931 990 999 1008 1017 1026
ATC AAG CTG CGG CTC CCT GCC AGT CCC CAG ACC CAC CTG CAC ATG CTC CGC CAC
KKLRLPASPETHLDMLRH
1035 1044 1053 1062 1071 1080
CTC TAC CAG GGC TGC CAG GTG GTG CAG GGA AACCTCGAACrCACCTACCTGCCC
LYQGCQVVQGNLELTYLP
1089 1098 1107 1116 1125 1134
ACC AAT GCC AGC CTC TCC TTC CTG CAG GAT ATC CAG CAG GTG CAG GGC TAC GTG
TNASLSFLQDIQEVQGYV
1143 1152 1161 1170 1179 1188
CTC ATC GCT CAC AAC CAA GTG AGG CAG GTC CCA CTG CAG AGG GTG CGG ATT GTG
LIAKNQVRQVPLQRLRIV
1197 1206 1215 1224 1233 1242
CGA GGC AQC CAG CTC TTT GAG CAC AAC TAT GCC CTG GCC GTG CTA GAC AAT GCA
RGTQLFEDNYALAVLDNG
12*1 1260 1269 1278 1237 1296
GAC CCG CTC AAC AAT ACC ACC CCT GTC ACA GGG GCC TCC CCA GGA GGC CTG CGG
£'-? t_ kt MTT ? VT GA S r G G L RFigure 49 suite 56/75
1305 1314 1323 1332 1341 1350
GAG CTG CAG CTT CGA AGC CTC ACA GAG ATC TTG AAA GGA GGG GTC TTC ATC CAG
ELQLRSLTEÎLKGGVLIQ
1359 1368 1377 1386 1395 1404
CGG AAC CCC CAG CTC TCC TAC CAG GAC ACG ATT TTG TCG A*J3 GAC ATC TTC CAC
RN'PQLCYQDTILWKDXFH
1413 1422 1431 1440 1449 1458
AAG AAC AAC CAG CTC GCT CTC ACA CTG ATA CAC ACC AAC CGC TCT CGG GCC TGC
R N N Q L A L TL IDTNRSRAC
----------1467 -T-X476 - 1485 1494--------------1503-------- 1512
CAC CCC TGT TCT CCG ATC TGT AAG GGC TCC CGC TGC TGG GGA GAG AGT TCT GAG
H P C S P M C KGSRCWGES SE
1521 1530 1539 1548 1557 1566
GAT TGT CAG AGC CTC ACG CGC ACT GTC TGT GCC GGT GGC TGT GCC CGC TGC AAG
DCQSLTRTVCAGGCARCK
1575 1584 1593 1602 1611 1620
GGG CCA CTG CCC ACT GAC TGC TGC CAT GAG CAG TGTGCT GCC GGC TGC ACG GGC
GPLPTDCCHEQCAAGCTG
1629 1638 1547 1656 1665 1674
CCC AAG CAC TCT GAC TGC CTG GCC TGC CTC CAC TTC AAC CAC AGT GGC ATC TGT
PKHSDCLACLHFNHSG IC
1683 1692 1701 1710 1719 1728
CAG CTG CAC TGC CCA GCC CTC GTC ACC TAC AAC ACA CAC ACG TTT GAG TCC ATG
ELHCPALVTYNTDTFESM
1737 ? 1746 1755 1764 1773 1782
CCC AAT CCC CAG GGC CGG TAT ACA TTC GGC GCC AGC TGT. GTG ACT GCC .TGT CCC
PNPEGRYTFGASCVTACP
1791 1800 1809 1818 1827 1836
TAC AAC TAC CTT TCT ACG CAC GTG GGA TCC TGC ACC CTC GTC TGC CCC CTG CAC
YjVYLSTDVGSCTLVCPLK
1845 1854 1863 1872 1881 1390
AAC CAA GAG GTG ACA GCA GAG GAT GGA ACA CAG CGG TGT GAG AAG TGC AGC AAG
NQEVTAEDGTQRCEKCSK
1899 1908 1917 1926 1935 1944
CCC TGT GCC CGA GTC TGC TAT.GGT CTC- GGC ATG GAG CAC TTC- CGA GAG GTC AGG
? C A R V C Y G - G Y. Z H L R S V RFigure 49 suite 57/75
1953 1962 1971 1980 1989 1998
GCA GTT ACC AGT GCC AAT ATC CAG GAG TTT GCT GGC TCC AAG AAG ATC TTT GGG
AVTSANIQEFAGCKK IFG
2007 2016 2025 2034 2043 2052
AGC CTC GCA TT? CTG CCG GAG" AGC TTT GAT GGG GAC CCA GCC TCC AAC ACT GCC
SLAFLPESFDGDPAS NTA
2061 2070 2079 2038 2097 2106
CCG CTC CAG CCA GAG CAG CTC CAA GTG TTT GAG ACT CTG GAA GAG ATC ACA GGT
2115 2124 2133 2142 2151 .2160
TAC CTA TAC ATC TCA GCA TGG CCG GAC AGC CTC CCT GAC CTC AGC GTC TTC CAG
YLYISAWPDSLPDLSVFQ
2169 2178 2187 2196 2205 2214
AAC CTG CAA GTA ATC CGG GGA CGA ATT CTC CAC AAT GGC GCC TAC TCG CTG ACC
NLQVIRGRILHKGAY S L T
2223 2232 2241 2250 2259 2268
CTG CAA GGG CTG GGC ATC AGC TGG CTG GGG CTC CGC TCA CTG AGG GAA CTC GGC
LQGLGI SWLGLRSLRELG
2277 2286 2295 2304 2313 2322
AGT GGA CTG GCC CTC ATC CAC CAT AAC ACC CAC CTC TGC TTC GTG CAC ACG GTG
SGLALIHKNTHLCFVKTV
2331 2340 2349 2358 2367 2376
CCC TGG GAC CAG CTC TTT CGG AAC CCG CAC CAA GCT CTC CTC CAC ACT GCC AAC
PWDQLFRNPF.QALLHTAN
2385 2394 2403 2412 2421- 2430
CGG CCA GAG GAC GAG TCT GTC GGC GAG GGC CTC GCC TGC CAC CAG CTG TGC GCC
TtPEDECVGEGLACHQLCA
2439 2448 2457 2466 2475 2484
CGA GGG CAC TGC TGG GGT CCA GGG CCC ACC CAG TGT GTC AAC TGC AGC CAG TTC
RGHCWGPGPTQCVNC SQF
2493 2502 2511 2520 2529 2538
CTT CGG GGC CAG CAG TGC GTG GAG GAA TGC CGA GTA CTG CAG GGG CTC CCC AGG
LRGQECVEECRVLQGLPR
2547 2556 2555 2574 2533 2592
GAG TAT GTG AAT GCC AGG CAC TGT TTG CCG TGC CAC CCT CAG TGT CAG CCC CAG
E Y V X A R H C L ? C K ? £ C Q ? QFigure49 suite
2601 2610 2619 2628 2637 2646
AAT GGC TCA GTG ACC TGT TTT GGA CCG GAG GCT GAC CAG TGT GTG GCC TGT GCC
NGSVTC FG PEADQCVACA
2655 2664 2673 2682 2691 2700
CAC TAT AAG GAC CCT CCC TTC TGC GTG GCC CGC TGC CCC AGC GGT GTG AAA CCT
HYKDPPFCVARCPSGVKP
2709 2718 2727 2736 2745 2754
GAC CTC TCC TAC ATC CCC ATC TGG AAG TTT CCA GAT GAG GAG GGC GCA TGC CAG
-D h .....S Y .. M?_P____I____W?......K_.__F_ P_ D E E G A C Q
2763 2772 2781 2790 2799 2808
CCT TGC CCC ATC AAC TGC ACC CAC TCC TGT GTG GAC CTG GAT GAC AAGGGC TGC
PCPINCTKSCVDLDDKGC
2817 2826 2835 2644 2853 2362
CCC GCC GAG CAG AGA GCC AGC CCT CTC ACG TCC GOG CAT CAT CAC CAT CAT CAT
P A E Q RAS? LTSGHHK H HH
Sali

TGA GTC GAC 3'59/75
O
m

i?
D)
a.
(U
eo
O
to
CM
o
I *o
©
Diam. ext
o
105 nm
o
4->
ro
en
.-H
<o -
u bi
?P SI)
c c
o
u
jj
(V c
u (0
4) ai
e o»
ta ca
M c
-IJ M
O D
Eh «
QJ
u
O
g
?H
a
60/75
Figùre51
m
o
E
<0
?H
Q
c
ID
O
E
m
-H
O
B
1,6
1,2
1
0,8
0,6
0,4
0,2
*
i^K* ^ N*'
surnageant
A
/ ^ K+ .*
V lysat
I ? ' l -?r
pur 1:2 1:4 1:8
surnageant
1:2 1:4 1:8
lysat61/75
Autres
molécules
effectrices
ajoutées
Fonctions
effectrices liées
à l'extrémité
N-terminale
Autres
molécules
effectrices
ajoutées
Molécule
co-stim.
scFv
Cytokine
Chémokine
scfv
Molécule
co-stim.
Cvtokine
Chémokine
V Noyau
' d'hétérominibody
:hemokine,
Cvtokine Molécule
co-stim.
scFv
Chémokine
Molécule Cvtokine
SCfv co-stim.
Autres
molécules
effectrices
ajoutées
Fonctions
effectrices liées
& l'extrémité
C-terminale
Figure 52
Autres
molécules
effectrices
ajoutéesFigure 53
62/75
Région charnière
d'IgG3
Fragment de liaison
glycine-sérine
Hu GM-CSF
HulL-2
Etiquette histidine63/75
e
3
U.
m
U
?
o
t
z
u
I
>
U.
U
en
R
Q
X
o
D.
X
? *
U
i
u
O
G
X
o
Û
&?
I
Figure 55a 64/75
M G W Ê
EcoRI Ncol
1 TTTTTTTC7T CCATTTCAGG TGTCGTGAGG AATTCACCAT GGGATGGAGC TGTATCATCC
AAAAÄAAGAÄ GG7AAAGTCC ACAGCACTCC T7AAG7GG7A CCC7ACC7CG ACATAGTAGG
+3LFLV ATATGVK SEL QMT QSP
BsrGI Sacl
61 TCTTCT7GGT AGCAACAGCT ACAGG7GTAC ACTCCGAGCT CCASATGACC CAGTCTCCAT
AGAAGAACCA TCGTTGTCGA TGTCCACR7S 7GAGGC7CGA GGTCTACTGG GTCAGAGGTA
+3SSLS ASV GDRV T I T CRA SQS
121 CCTCCCTGTC TGCATCTGTA GGAGACAGAG TCACCATCAC TTGCCGSGCA AGTCAGAGCA
GGAGGGACAG_ACGTAGACA7 CCTCTGTCTC AGTGGTAGTG AACGGCCCGT TCAGTCTCGT
+3 IS S Y ?Ir N-W Y OQ K- P G Q P-P K -LL I
SwaI
131 TTAGCAGCTA TTTAAAT7GG TATCAGCAGA AACCAGGACA GCCTCCTÄAG CTGCTCA7TT
AATCGTCGAT AAA7TTAACC ATAGTCGTC7 T7GG7CCTGT CGGAGGATÎC GACGAG7AAA
*3 Y W A S TRE SGVP DR F SGS ESG
Smal
2*1 ACTGGGCATC TACCCGGGAA TCCGGGGTCC CTGACCGATT CAGCGGCAG7 GAATCTGGGA
TGACCCGTAG ATGGGCCCT7 AGGCCCCAGG GAC7GGCTAA GTCGCCGTCA CTTAGACCCT
+3 T N Y T LTI SSLQ PED FAT Y F C
PstI
3C1 CAAA7TACAC 7CTCACCATC AGCAGCCTGC AGCCTC-AAGA TTT7GC7ACT TACTTT7GTC
G7TTAATGTG AGAGTGGTAG TCGTCGGACG 7CGGAC7TCT AAAACGATGA ATGAAAACAG
+3QQS0 S t. ? ITFG QGT RLD IQG
361 AACAGTC7GA CAGTTTGCCG ATCACCTTCG GCCAAGGGAC ACGACTGGAC ATTCAAGGAG
TTGTCAGACT G7CAAACGGC TAGTGGAAGC CGGTTCCCTG TGCTGACCTG TAAGTTCC7C
»3 G G G S GGG GSGG GGS S V Q LIE
PvuII
4 21 GAGGAGGATC AGGTGG7GG7 GGTAGCGGCG GCGGCGGCTC AGAGG7GCAG CTGCTCGAGT
CTCCTCC7AG TCCACCACCA CCATCGCCGC CGCCGCCGAG TC7CCACGTC GACGAGCTCA
+3SGGG VVQ P G R S L R L SCA ASG
481 CTGGGGGAGG CGTC-GTCCAG CC7GGGAGGT CCCTGÄGACT CTCCTGTGCA GCCTCTGGA7
GACCCCCTCC GCACCAGGTC GGACCCTCCA GGGACTCTGA GAGGACACGT CGGAGACCTA
?O F î F S S Y G M H W V R Q A P G K GLE
541 7CACCTTCAG TAGCTATGGC ATGCACTGGG TCCGCCAGGC 7CCAGGCAAG GGGCTGGAGT
AGTGGAAGTC A7CGA7ACCG TACGTGACCC AGGCGGTCCG AGG7CCGTTC CCCÇACCTCA
+3WVAV ISY D G S N K . Y Y ADS VKG
Ndel
601 GGGTGGCAGT TATATCATAT GATGGAAGTA ATAAATACTA TC-CAGACTCC GTGAAGGGCC
CCCACCG7CA ATATAG7ATA CTACCT7CAT TAT7TA7GAT AC3TCTGAGG CACTTCCCGG
+3 R : T I SRD NSKN TLY L Q M N S L
661 GA7TCACCAT CTCCAGAGAC AATTCCAAGA ACACGC7G7A 7C7GCAAATG AACAGCCTGA
C7AAG7GGTA GAGG7CTC7G T7AAGGT7C7 TG7GCGACAT AGACG77TAC T7GTCGGAC7
+ 3 R A E D 7AV YYCA KDM GWG S G W
721 GAGCïGAGGA CACGGC737G TATTACTGTG CGAAAGATAT GGGG7GGGGC AGTGGCTGGÄ
CTCGACTCC7 G7GCCGACAC ATAATGACAC GCTT7C7A7A CCCCACCCCG TCACCGACC7Figure 55a suite 65/75
+ 3 R P Y Y YYG MDVW GQG TTV TVS
BSpEI
781 GACCC7ACTA C7ACTACGGT ATGGACGTC7 GGGGCCAAGG GACCACGGTC ACCGTCTCC7
CTGGGATGAT GATGATGCCA TACCTGCAGA CCCCGGTTCC CTGGTGCCAG TGGCAGAGGA
+ 3SGTP LGD T T H T AST KGP SVF
SspEI Nhel
841 CCGGAACCCC GC7GGGTGAC ACCACCCACA CCGCTAGCAC CAAGGGCCCA TCGGTCTTCC
GGCC7TGGGG CGACCCACTG TGGTGGGTGT GGCGATCGTG GTTCCCGGGT AGCCAGAAGG
*3 P L A P SSK STSG GTA ALG CLV
901 CCCTGGCACC CTCCTCCAAG AGCACCTCTG GGGGCACAGC GGCCCTGGGC 7GCCTGGTCA
GGGACCGTGG GAGGAGGTTC TCGTGGAGAC CCCCGTGTCG CCGGGACCCG ACGGACCAGT
? +3 K D Y F P- E P .....V -T-?V-- S W - "N S -- G A L T S G -
Agel
961 AGGACTACTT CCCCGAACCG GTGACGG7GT CGTGGAACTC AGGCGCCCTG ACCAGCGGCG
TCCTGATGAA GGGGCTTGGC CACTGCCACA GCACC7TGAG TCCGCGGGAC TGGTCGCCGC
+ 3VHTF PAV LQSS GLY SLS SVV
1021 TGCACACCTT CCCGGCTGTC CTACAG7CCT CAGGACTCTA CTCCCTCAGC AGCGTGGTGA
ACGTGTGGAA GGGCCGACAG GATGTCAGGA GTCCTGAGAT GAGGGAGTCG TCGCACCACT
+3TVPS SSL GTQT YIC N V N HKP
1081 CCGTGCCCTC CAGCAGCTTG GGCACCCAGA CCTACATCTG CAACGTGAAT CACAAGCCCA
GGCACGGGAG GTCGTCGAAC CCGTGGGTCT GGATGTAGAC GTTGCACTTA GTGTTCGGGT
+3SNTK-VDK KVEP KSC DKT SGG
Spel
1141 GCAACACCAA GGTGGACAAG AAAGTTGAGC CCAAATCTTG TGACAAAACT AGTGGAGGCG
CGTTGTGGTT CCACCTGTTC TTTCAACTCG GGTTTAGAAC ACTGTTTTGA TCACCTCCGC
+3GGSA PAR SPSP STQ PWE HVN
1201 GTGGGTCCGC ACCCGCCCGC TCGCCCAGCC CCAGCACGCA GCCCTGGGAG CATGTGAATG
CACCCAGGCG TGGGCGGGCG AGCGGGTCGG GGTCGTGCGT CGGGACCCTC GTACACTTAC
+3AIQE ARR LLNL SRD TAA EMN
1261 CCATCCAGGA GGCCCGGCGT CTCCTGAACC TGAGTAGAGA CACTGCTGCT GAGATGAATG
GGTAGGTCCT CCGGGCCGCA GAGGACTTGG ACTCATCTCT GTGACGACGA CTCTACTTAC
+3ETVE VIS EMFD LQE PTC LQT
1321 AAACAGTAGA AGTCATCTCA GAAATGTTTG ACCTCCAGGA GCCGACCTGC CTACAGACCC
TTTGTCATCT TCAGTAGAGT CTTTACAAAC TGGAGGTCCT CGGCTGGACG GATGTCTGGG
+3RLEL YKQ GLRG SLT KLK GPL
BsrGI
1381 GCCTGGAGCT GTACAAGCAG GGCCTGCGGG GCAGCCTCAC CAAGCTCAAG GGCCCCTTGA
CGGACCTCGA CATGT7CGTC CCGGACGCCC CGTCGGAGTG GTTCGAGTTC CCGGGGAACT
+ 3TMMA SHY KQHC PPT PET SCA
1441 CCATGATGGC CAGCCACTAC AAGCAGCACT GCCCTCCAAC CCCGGAAACT TCCTGTGCAA
GGTACTACCG GTCGGTGATG TTCGTCGTGA CGGGAGGTTG GGGCCTTTGA AGGACACGTT
+3TQII TFE SFKE N L K DFL LVI
1501 CCCAGATTAT CACCTT7GAA AGTTTCAAAG AGAACCTGAA GGACTTTCTG C7TGTCATCC
GGGTCTAATA G7GGAAACT7 TCAAAGT7TC TCTTGGB.CTT CCTGAAAGAC GAACAGTAGG66/75
Figure55a suite
+3PFDC tfEP.VQEH HHH HH
Sail
1561 CCTTTGACTG C7GGGAGCCA GTCCAGGAGC ATCATCACCA TCATCATTGA GTCGACTTAA
GGAAACTGAC GACCC7CGG7 CAGGTCCTCG TAGTAGTGGT AGTAGTAACT CAGCTGAAT7
1621 AACAGCTCTG
TTGTCGAGAC, Figure 55b 67/75
M SWS
=:=oRI Ncol
L TT777TTCTT CCAT77CAGG TGTCGTGAGG AATTCACCAT GGGATGGAGC TGTATCATCC
AAAAAAAGAA GGTAAAGTCC ACAGCACTCC 7TAAGTGGTA CCCTACC7CG ACATAGTAGG
-3 1FLV ATA TGVH SEL QMT CSP
BsrGI Sacl
61 TC7TCT7GGT AGCAACAGC7 ACAGGTGTAC ACTCCSAGCT CCAGA7GACC CAGTCTCCAT
AGAAGAACCA TCGTTGTCGA TGTCCACATG 73AGGC7CGA GGTCTACTGG GTCAGAGGTA
-3 S S L 5 A S V GDRV TIT CRA SQS
121 CCTCCCTGTC TGCATCTGTA GGAGACAGAG TCACCA7CAC TTGCCGGGCA AGTCAGAGCA
GGAGGGACAG ACGTAGACA? CCTC7GTCTC AG7GGTAGTG AACGGCCCGT TCAGTCTCG7
+3ISSY LN-K YQQK PGQ PPK L L r
...-.._ - - Swal . ------.....---------------------- -......-......
131 TTAGCAGCTA 777AAA77GG TATCAGCAGA AACCAGGACA GCCTCCTAAG C7GCTCATT7
AATCGTCGAÎ AAÄTTTAACC ATAG7CGTCT TTGGTCCTGT CGGAGGAT7C GACGAGTAAA
^3 Y W A S TRE SGVP DRF SGS 2 S G
Smal
241 AC7GGGCATC 7ACCCGGGAA TCCGGGGTCC C7GACCGA7T CAGCGGCAGT GAATCTGGGA
TGACCCGTAG ATGGGCCCTT AGGCCCCAGG GACTGGCTAA GTCGCCGTCA C7TAGACCCT
+3TNYT LTI SSLQ PED FAT YFC
PstI
301 CAAATTACAC 7CTCACCATC AGCAGCCTGC AGCCTGAAGA TTTTGCTACT 7ACT7T7G7C
G77TAATGTG AGAG7GGTAG TCG7CGGACG TCGGACTTCT AAAACGATGA ATGAAAACAG
+3QQSD SLP ITFG QGT R" L D IQG
361 AACAGTCTGA CAG7TTGCCG A7CACCTTCG GCCAAGGGAC ACGACTGGAC ATTCAAGGAG
TTGTCAGACT GTCAAACGGC TAGTGGAAGC C3GTTCCCTG TGCTGACC7G TAAGTTCCTC
*3 G G G 5 GGG GSGG GGS EVQ L L S
?vui:
421 GRGGAGGATC AGGTGGTGGT GGTAGCGGCG GCGGCGGCTC AGAGG7GCAG C7GCTCGAG7
C7CC7CCTAG 7CCACCACCA CCATCGCCGC C3CCGCCGAG TCTCCACGTC GACGAGCTCA
+3 S GGG VVQ PGRS L R L SCA ASG
481 CTGGGGGAGG CGTGGTCCAG CCTGGGAGGT CCCTGAGACT CTCCTGTGCA GCCTCTGGAT
GACCCCCTCC GCACCAGGTC GGACCCTCCA GGGACTCTGA GAGGACACGT CGGAGACCTA
+3FTFS SYG M H H V RQA PGK GLE
541 TCACCTTCAG TAGCTA7GGC ATGCACTGGG 7CCGCCAGGC TCCAGGCAAG GGGCTGGAGT
AG7GGAAG7C ATCGATACCG TACGTGACCC AGGCGGTCCG AGGTCCGTTC CCCGACCTCA
+3WVAV ISY D G S N KYY ADS VKG
Ndel
601 GGG7GGCAGT TATATCATAT GATGGAAGTA ATAAATACTA TGCAGACTCC G7GAAGGGCC
CCCACCG7CA ATATAGTATA CTACCTTCAT 7ATTTATGAT ACGTCTGAGG CACTTCCCGG
+3RFTI SRD NSKN TLY LQM NSL
661 GA7TCACCAT C7CCAGAGAC AATTCCAAGA ACACGCTGTA 7CTGCAAATG AACAGCC7GA
C7AAGTGG7A GAGGTCTCTG TTAAGGT7CT 7G7GCGACA7 AGACG7TTAC 77GTCGGAC7
?O R A E D TAV YYCA KDM GWG SGW
7 21 GAGCTGAGGA CACGGCTGTG TATTACTGTG CGAAAGATAT GGGGTGGGGC AG7GGCTGGA
CTCGACTCCT GTGCCGACAC A7AATGACAC GCTTTCTATA CCCCACCCCG TCACCGACCTFigure 55b suite 68/75
+ 3 R ? Y Y YYG « D V W GQG ?TV TVS
BspEl
781 GACCCTACTA C7ACTACGGT ATGGACGTC7 GGGGCCAAGG GACCACGGTC ACCGTCTCC7
CTGGGA7GAT GA7GA7GCCA 7ACCTGCAGA CCCCGG7TCC CTGG7GCCAG 7GGCAGAGGA
-3 S G T ? LGC T7HT RTV AAP SVF
BspEl BsiWI
S41 CCGGAACCCC GC7GGGTGAC ACCACCCACA CCCG7ACGGT GGCTGCACCA TCTGTCTTCA
GGCCTTGGGG CC-ACCCAC7G TGG7GGGTGT GGGCATGCCA CCGACGTGGT AGACAGAAG7
+3IFPP SDE Q L K S GTA SVV CLL
901 TCTTCCCGCC A7CTGATGAG CAGTTSAAA? CTGGAACTGC CTCTGTTGTG TGCCTGCTGA
AGAAGGGCGG TAGACTACTC GTCAAC7TTA GACCTTGACG GAGACAACAC ACGGACGACT
O N N F Y PRE AKVQ.WKV DNA LQS
....9.61 ,.ATAACTTC7A. 7CCCA5AGAG GCCAAAGTAC-AGTGGAAGGTGGATAACGCC-CTCCAATCGG
7A77GAAGAT AGGGTCTCTC CGGTTTCATG TCACCT7CCA CCTATTGCGG GAGGTTAGCC
-3GNSQ ESV TEQDSKO STY SLS
1021 GTAACTCCCA GGAGAGTGTC ACAGAGCAGG ACAGCAAGGA CAGCACCTAC AGCCTCAGCA
CATTGAC-GG? CC7C7CACAG TGTCTCGTCC 7GTCGTTCCT G7CGTGGATG TCGGAGTCG7
+ 3S7LT LSK ADYE KHK. VYA CEV
1081 GCACCC73AC GCTGAGCAAA GCAGACTACG AGAAACACAA AGTCTACGCC TGCGAAG7CA
CGTGGGACTG CGACTCGTTT CGTCTGATGC TCTTTGTGTT TCAGATGCGG ACGCTTCAGT
+3THQG LSS PVTK S F N R G E CSG
Sacl
1141 CCCATCAGGG CCTGAGCTCG CCCG7CACAA AGAGCTTCAA CAGGGGASAG TGTTCAGGAG
GGG7AG7CCC GGAC7CGAGC GGGCAGTGTT TCTCGAAGT7 GTCCCCTCÏC ACAAGTCCTC
+3GGGS APT SSST KKT QLQ LEH
120Ï GCGGTGGGTC TGCACCTACT TCAAGTTCTA CAAAGAAAAC ACAGCTACAA CTGGAGCATT
CGCCACCCAG ACGTGGATGA AG7TCAAGAT GTTTCTTTTG TGTCGA7GTT GACCTCGTAA
-3LLLD 1QM ILNG INN YKN P K L
1261 TACTGC7GGA 7T7ACAGATG AT77TGAATG GAA77AATAA TTACAAGAAT CCCAAACTCA
ATGACGÂCCT AAATGTCTÀC TAAAACTTAC CTTAATTAïT AATGTTCTTA GGGT7TGAGT
+ 3TRMLTFK FYMP KKA TEL KHL
1321 CCAGGATGCT CACA77TAAG 7TTTACATGC CCAAGAAGGC CACAGAACTG AAACATCT7C
GGTCC7ACGA GTGTAAATTC AAAATGTACG GGTTCTTCCG GTGTCTTGAC T7TGTAGAAG
+ 3 Q C L E EEL KPLE S V L N L A QSK
Xbal
1381 AG7GTC7AGA AGAAGAACTC AAACCTCTGG AGGAAGTGCT AAATTTAGCT CAAAGCAAAA
TCACAGATC7 TCTTCT7GAG TTTGGAGACC TCCTTCACGA TTTAAATCGA GTTTCGTTTT
O N F H L RPR DLIS NIN VIV LEL
1441 ACTTTCAC7T AAGACCCAGG GACTTAATCA GCAATATCAA CGTAATAGTT C7GGAACTAA
TGAAAGTGAA TTCTGGGTCC CTGAATTAGT CGTTATAGTT GCA7TATCAA GACCTTGATT
+ 3KGSE TTF MCSY ADE TAT IVE
1501 AGGGA7CTGA AACAACATTC ATGTGTGAAT ATGCTGATGA GACAGCAACC AT7GTAGAAT
7CCC7AGACT TTG7TGTAAG TACACAC7TA TACGACTACT CTGTCG7TGG 7AACATCTTA
~3 F L N R » : T FCQS IIS TLT * *
Sali
1561 TTCTGAACAo ATGGATTACC TT77GTCAAA GCATCATCTC AACACTAACT TGATAAGTCG
AAGACT7GTC 7ACCTAATGG AAAACAGTTT CGTAGTAGAG 77GTGAÎ7GA ACTATTCAGC69/75
Figure 55b suite
Sali
1621 ACTTAAAACA
TGAATT7TG770/75
FIGURE 56
LiiiiiuijmljlJiLI'mfj ?«
OS I Coups 0
OSt Coups 0
-fl-
or O
JA

« M
OSt Coups P
ID
?O
C
o
?H
-P
(0
-H
U
O
01
«
iftfj uii|tii|| iiilj»
OSI coups °

-?*o
Ogi coups °
OSI Coups 071/75
fc
£
u.
kV
«
Pi
O
m
?H
(0
?H
(0
<D
?H
D
-H
?H
KV 0)
U 0
nQ)
0 -P
"0 o
KV
+J 4-)
c öl
(0 C
<u fd
<T> M
(O -U
c
M c
P o
n c
.. o
X
iH o
«
OJ
M
3
-H
rH '+
KV M
O (O tu
Pj Ol
0) U
-o tn 1 CN]
KV S 1
*J ^Q) o J
c V t H
fO O i-H 1
Q> KV a: a;
Cn <w u o
(0 m i i
c C > >
M m [n tu
0 M o O
m +j 0Ï m
O o
?- o r» r-
se Q Q
(N o K OC
CM
O S O" 0- O
OOO
Diam. ext. 40572/75
S
e
u.
m
Q)
?H
D
?H
M
(1) «
(J 0)
?<1J
C) 4-»
71 O
(!)
4-t «W
C ÜÏ
m C
m m
m M
m +j
c
u c:
0 o
m c
.. o
x
iH o
m
(D
H
D
?H
-H +
0) M
(1 ro Ua
a co
0> O
0 V) 1 CM
a) >: t
u ^ o kJ
c ?P i IH
m D iH 1
a> d) K M
cr« KH O O
m Cf) t 1
c c: > >
M rd tu [u
3 M O (J
m U M rn
O o
? ? O C- r-
n: Q Q
<M O X X
CV
o o
Diam. ext. 40573/75
Q
«
CM
I KV
J C
M -H
rO
-H E
+J 3
C -C
C
-H
fd

-H
4->
CM
*/>
M <p
(d -H
P« Q
a
c
o
?rl
a o
u
o s
O H

io
ß
(/>
kDa [poids moléculaire]74/75
O
c
?H
î
M
Ä
O
S
O
«H
01
01
O
0}
tu
co
u
?s
?rt
>
?H
O
o
?H
e
.S*
O 3,5 o co- in c\f 2,0 in TT
Diam. ext. 450
IO
o"
Ó
o75/75
O
ï
u
MD
-y
MD
J3
I
O
(H
<d
H
Ol
O
Ol
«M
?H"
H
O
?O
,<D
?P
?rt
>
?rt
?M
O
(0
o
?rt
ta
e
a.
.

r
co
o
co-
in
o
cm"
in
in
o"
o
o
i
o
s
2
o
E
Csf
Jl
O
o
I
o
o
o
o
I
CM
U.

co S
o x
I
O
Diam. ext. 450